ID: 1063310734

View in Genome Browser
Species Human (GRCh38)
Location 10:4949541-4949563
Sequence GACACCTATGTCAATATGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063310731_1063310734 -4 Left 1063310731 10:4949522-4949544 CCCAAAGTGTGGACTTTCTGACA 0: 1
1: 0
2: 0
3: 23
4: 197
Right 1063310734 10:4949541-4949563 GACACCTATGTCAATATGGTTGG No data
1063310732_1063310734 -5 Left 1063310732 10:4949523-4949545 CCAAAGTGTGGACTTTCTGACAC 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1063310734 10:4949541-4949563 GACACCTATGTCAATATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063310734 Original CRISPR GACACCTATGTCAATATGGT TGG Intronic
No off target data available for this crispr