ID: 1063313339

View in Genome Browser
Species Human (GRCh38)
Location 10:4977765-4977787
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 2, 1: 0, 2: 1, 3: 22, 4: 277}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063313332_1063313339 29 Left 1063313332 10:4977713-4977735 CCTAATTATCCATTTTCTGATGA 0: 2
1: 0
2: 4
3: 52
4: 578
Right 1063313339 10:4977765-4977787 CTGCCAGAAGGCCCTGCGTGTGG 0: 2
1: 0
2: 1
3: 22
4: 277
1063313333_1063313339 20 Left 1063313333 10:4977722-4977744 CCATTTTCTGATGAATATTAACA 0: 2
1: 1
2: 5
3: 48
4: 432
Right 1063313339 10:4977765-4977787 CTGCCAGAAGGCCCTGCGTGTGG 0: 2
1: 0
2: 1
3: 22
4: 277
1063313331_1063313339 30 Left 1063313331 10:4977712-4977734 CCCTAATTATCCATTTTCTGATG 0: 2
1: 0
2: 3
3: 41
4: 402
Right 1063313339 10:4977765-4977787 CTGCCAGAAGGCCCTGCGTGTGG 0: 2
1: 0
2: 1
3: 22
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900114927 1:1024367-1024389 CTACCAGAGGGCCCAGGGTGGGG - Intronic
900115369 1:1025779-1025801 CTACCAGGAGCCCCTGGGTGGGG - Intronic
902459910 1:16566532-16566554 GAGCCTGAAGTCCCTGCGTGAGG - Intronic
902555148 1:17242557-17242579 CTGCCGGAAGCCCCTGACTGTGG + Intronic
902821437 1:18945702-18945724 CTGGCAGAAGCCCCTCCATGTGG - Intronic
904722263 1:32519163-32519185 CCGCCTGAAGGACCTGCCTGAGG + Intronic
904749676 1:32733790-32733812 CTTCCAGAAGGCCCTGAGTGTGG + Intergenic
905202020 1:36322120-36322142 CTGCCAGAAGACCCCGGGGGCGG - Exonic
907397286 1:54200175-54200197 TTCCCAGCAGGCCCTGCGCGCGG + Exonic
907624865 1:56020167-56020189 CCGCCTGAAGGACCTGCCTGAGG + Intergenic
907715636 1:56923519-56923541 CTGCAAGAAGTCACTGGGTGGGG - Intergenic
908045129 1:60160736-60160758 CTGCCAGAATGCCTTGCCAGTGG - Intergenic
908826953 1:68142261-68142283 CTGGCACAAGGACCTGTGTGTGG + Intronic
909765181 1:79346956-79346978 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
910773347 1:90851446-90851468 CGGGCAGAGGGCCCTGCTTGGGG - Intergenic
912176998 1:107171594-107171616 CTTCCAGACTGCCCTGTGTGTGG + Intronic
912385416 1:109268932-109268954 CCGCTACGAGGCCCTGCGTGGGG + Exonic
915896672 1:159816642-159816664 CTTCCTGAAGGACCTGCTTGAGG - Intergenic
917260535 1:173162526-173162548 CCTCCTGAAGGCCCTGCCTGAGG + Intergenic
917455418 1:175181970-175181992 CTGCAAGAAGGCCCTGGGAGAGG - Intronic
919750507 1:201034790-201034812 CTGCCAGAAGGGGCGGGGTGTGG - Intergenic
920949396 1:210558165-210558187 CTGGCAGAAGGCTCTGTGTTAGG - Intronic
922471010 1:225877321-225877343 TTCCCAGAAGGCCCTGGGTGGGG + Intronic
922630184 1:227099272-227099294 CTTCCTGAAGGACCTGCCTGAGG - Intronic
922909655 1:229204989-229205011 CTCCCAAAAGGCCCTGGCTGGGG - Intergenic
923724122 1:236491760-236491782 GTGCCAGCAGGCCCAGAGTGTGG - Intergenic
924273892 1:242365228-242365250 GTGCAGGAAGGCCCTGCATGGGG + Intronic
1063313339 10:4977765-4977787 CTGCCAGAAGGCCCTGCGTGTGG + Exonic
1063314614 10:4989951-4989973 CTGCCAGAAGGCCCTGCGTGTGG - Exonic
1063336341 10:5218783-5218805 CTAGCAGAAGGCCCTGTGTGTGG + Exonic
1066710821 10:38231448-38231470 GTGCAGGAAGGCCCTGCATGGGG - Intergenic
1066757798 10:38728405-38728427 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1067188386 10:44049457-44049479 CTGCCAGCAGGCCCAGCTGGAGG - Intergenic
1067826213 10:49575244-49575266 CCTCCAGAAGGCCCTGCCTGAGG + Intergenic
1068362992 10:56004274-56004296 CTGCCTGAAGGCCATGTCTGAGG + Intergenic
1068756091 10:60655243-60655265 CTTCCAGAAGGACCTGCCTGAGG - Intronic
1068912471 10:62393193-62393215 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1069153182 10:64991810-64991832 CTGCCACAAGGACGTGCCTGAGG - Intergenic
1069589672 10:69634098-69634120 CTGCGTGGAGGCCCTGCCTGGGG + Intergenic
1069819119 10:71216894-71216916 CTGCCTGCAGGCCCTGGGGGAGG - Intronic
1070407777 10:76112245-76112267 CTGCCAGGAGGCTCTGGGTGGGG + Intronic
1070649253 10:78222960-78222982 CTGCCAGAGGGGCCAGCGTGGGG - Intergenic
1072189644 10:93069215-93069237 CTGCCAGAGGGCCTTCCGTCAGG - Intergenic
1072325154 10:94290631-94290653 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1072998112 10:100264643-100264665 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1073093978 10:100969123-100969145 AGGCCAGAAGGCCCTCCGAGAGG + Intergenic
1074865032 10:117539949-117539971 CAGCCAGATGTCCCTGCCTGGGG + Intergenic
1075074962 10:119344618-119344640 CTTCCAAAAGGCCCTGCAGGGGG - Intronic
1076215990 10:128693688-128693710 ATGCAAGAATGCCCTGCATGGGG - Intergenic
1076787174 10:132756751-132756773 CTGCCTGAAGGACCTGCCTGAGG - Intronic
1077028379 11:451815-451837 CTCACGGAAGACCCTGCGTGGGG - Intronic
1077085789 11:749797-749819 CTGCCAGAATGCACTGAATGAGG - Intronic
1077089634 11:772579-772601 CTCCCAGATGCCCCTGCTTGTGG + Intronic
1080480565 11:32645232-32645254 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1080684570 11:34504516-34504538 CTACCAGAAGCCCCTGCCTCTGG - Intronic
1081604861 11:44520719-44520741 CAGGCAGAAGGACCTGTGTGGGG - Intergenic
1083281995 11:61632611-61632633 CTGCCAGAAGGGTCTGTGTCAGG - Intergenic
1083399402 11:62413574-62413596 CTGCCAGAAGGCATTGGCTGAGG - Intronic
1083989988 11:66240993-66241015 CCGGCAGAAGCCCCTGCGGGCGG - Intronic
1083997664 11:66280067-66280089 CTGTGGGAAGGCCCTGGGTGGGG - Intronic
1084571362 11:69961955-69961977 CAGCCAGAAGGCACTGGGAGAGG + Intergenic
1088557920 11:111081492-111081514 CTGCCTCAAGGCCCTCAGTGAGG - Intergenic
1089583404 11:119495463-119495485 CAGCCAGAGGGACCTGCCTGAGG + Intergenic
1090361238 11:126174218-126174240 CCTCCTGAAGGCCCTGCCTGAGG + Intergenic
1090803887 11:130190548-130190570 CTGCCAGTGGGCCCTGCGGGGGG + Exonic
1090805540 11:130199854-130199876 GTGCCAGGAGACCCTGTGTGGGG - Intronic
1090912817 11:131136207-131136229 CCCTCAGAAGGCCCTGCATGTGG - Intergenic
1091097019 11:132833458-132833480 CCTCCTGAAGGCCCTGCCTGAGG + Intronic
1092282329 12:7108007-7108029 CAGCAAGCAGGCCCTGCGTTTGG - Intronic
1092992218 12:13913706-13913728 ATGCTAGAAGTCCCTGAGTGTGG - Intronic
1094641946 12:32284179-32284201 CTGCCAGAACTCCCTGCCAGTGG + Intronic
1094829398 12:34293070-34293092 TTCCCAGCAGTCCCTGCGTGGGG - Intergenic
1094829442 12:34293263-34293285 TTCCCAGCAGCCCCTGCGTGGGG - Intergenic
1094829659 12:34294282-34294304 TTCCCAGCAGCCCCTGCGTGGGG - Intergenic
1094830650 12:34298658-34298680 TTCCCAGCAGCCCCTGCGTGGGG + Intergenic
1094830932 12:34299935-34299957 TTCCCAGCAGCCCCTGCGTGGGG + Intergenic
1094834245 12:34314796-34314818 ATCCCAGCAGCCCCTGCGTGGGG - Intergenic
1094837629 12:34329551-34329573 TTACCAGCAGCCCCTGCGTGGGG - Intergenic
1094837952 12:34331021-34331043 CTTCCAGGAGACCTTGCGTGGGG - Intergenic
1096178850 12:49539710-49539732 GGGCCAGAAGTCCCTGGGTGTGG + Intronic
1097649426 12:62278274-62278296 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1105780485 13:23701790-23701812 CTGTCCGAAGGCCCTGGCTGTGG - Intergenic
1108554908 13:51583349-51583371 CTACCAGAAGGCCTGGCATGTGG - Intergenic
1111421401 13:88016371-88016393 CTTCCTGAAGGACCTGCCTGCGG - Intergenic
1112506673 13:99980241-99980263 CTGGCAGGAGGCTCTGCGCGCGG - Intergenic
1112721514 13:102251329-102251351 CAGTCAGAAGGCTCTGAGTGAGG + Intronic
1114467015 14:22930376-22930398 CTGCCAGCGGCGCCTGCGTGGGG - Intergenic
1114856857 14:26457738-26457760 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1115210405 14:30961965-30961987 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1115351419 14:32399537-32399559 TCCCCAGAAGGCCCTGCTTGAGG - Intronic
1117123066 14:52590013-52590035 CTTCCTGAAGGACCTACGTGAGG - Intronic
1117873805 14:60228952-60228974 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1118524947 14:66629470-66629492 CTGCCTGAAGGAACTGCCTGAGG + Intronic
1118611256 14:67542024-67542046 CTGCCATAAACCTCTGCGTGTGG - Intronic
1118816221 14:69316148-69316170 CTGCCAGAAGCCTATGAGTGGGG + Intronic
1119082004 14:71703740-71703762 CTGCCAGCAAGCCCTTTGTGAGG + Intronic
1119319087 14:73718869-73718891 CCACCAGCAGGCCCTGCGGGAGG - Exonic
1121008365 14:90504864-90504886 CTGCCAGGTGTCCCAGCGTGGGG - Intergenic
1121327747 14:93031330-93031352 CTGGCAAAAGGCCATGAGTGAGG + Intronic
1122263985 14:100538286-100538308 CTGCCAGGTGGCCCTGGGAGAGG + Exonic
1122595408 14:102887000-102887022 CTGCCAGAAGGGCCCCTGTGTGG + Intronic
1122721641 14:103725605-103725627 CTGCCAGGAGGCCCTCACTGAGG - Intronic
1122784783 14:104158642-104158664 CTGCCAGAATGCCAGGCCTGAGG + Intronic
1123019114 14:105389355-105389377 CTGCCTGCAGGCTGTGCGTGGGG + Intronic
1124631927 15:31342986-31343008 CAGCAAGCAGGCCCTGCCTGGGG - Intronic
1124665908 15:31592542-31592564 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1126624418 15:50672391-50672413 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1127897987 15:63319521-63319543 CCTCCTGAAGGACCTGCGTGAGG - Intergenic
1129056849 15:72826281-72826303 CTGTCAGGAGGCCCTGGGTGGGG + Intergenic
1129228255 15:74182250-74182272 CAGCCAGAAGGGCCTGCCAGTGG + Exonic
1129917145 15:79283668-79283690 CTTCCAGAAGGCCGAGCATGGGG - Intergenic
1130162535 15:81415473-81415495 CTCCTAAAAGGCCCTGCCTGGGG - Intergenic
1130286776 15:82562269-82562291 CTACCAGAAGTCCCTGCTTTAGG + Intronic
1130300677 15:82678067-82678089 CAGCCAGAAGGGCCTGGGAGAGG - Intronic
1130960132 15:88653591-88653613 CTGGGAGAAGGCCCTGGGTCAGG - Intronic
1131176721 15:90213929-90213951 CTGACAGAAGGGCCTACTTGAGG + Intronic
1131389076 15:92032630-92032652 TTGGCAGAAAGCCCTGGGTGCGG + Intronic
1132544576 16:527454-527476 CTCCCAGAGGGCCTTGCGAGGGG - Intergenic
1132551228 16:554661-554683 CTTCCACAGGGCCCTGCGCGGGG - Intergenic
1132882286 16:2167782-2167804 CTGAAAGAAGACCCTGCCTGGGG + Intronic
1132892127 16:2209649-2209671 CTGCCAGCAGCTCCTGGGTGTGG + Exonic
1132897453 16:2235855-2235877 CTGGCAGAAGCCCCTGGGTGGGG - Exonic
1134444631 16:14321545-14321567 CAGTCAGAAGGCCCTGAGGGAGG + Intergenic
1136276202 16:29180705-29180727 CTGTCTGAAGGGCCTGCGGGAGG + Intergenic
1136725072 16:32350819-32350841 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1136933304 16:34437153-34437175 CTGCGTGAAGCCCCTGCCTGGGG + Intergenic
1136971268 16:34974661-34974683 CTGCGTGAAGCCCCTGCCTGGGG - Intergenic
1140489545 16:75323397-75323419 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1141504121 16:84463420-84463442 GTTCCAGAAGGGCCTGCCTGTGG - Intronic
1141535129 16:84673849-84673871 CTGCCTAAAGGACCTGCCTGAGG + Intergenic
1141648351 16:85379210-85379232 CTGCCAGATGGCACTGCATGCGG - Intergenic
1141656143 16:85417626-85417648 CTGCCAGATGTCCCTGGGTATGG + Intergenic
1141870036 16:86779023-86779045 CTGCCAGCAGTGGCTGCGTGGGG - Intergenic
1142080581 16:88146764-88146786 CTGTCTGAAGGGCCTGCGGGAGG + Intergenic
1203001358 16_KI270728v1_random:166935-166957 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1203132961 16_KI270728v1_random:1703339-1703361 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1203148560 16_KI270728v1_random:1818989-1819011 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1143148279 17:4790248-4790270 CGGCCAGCAGGCTCTGGGTGCGG - Exonic
1145963547 17:28901466-28901488 GGGGCAGCAGGCCCTGCGTGGGG - Intronic
1146078047 17:29751066-29751088 CTTCCTGAAGGACCTGCCTGAGG + Intronic
1146458479 17:33025349-33025371 CTGCCTGAGGGGCCTGCGGGGGG - Intronic
1148859002 17:50594259-50594281 CAGGCAGCAGGCCCTGTGTGAGG + Intronic
1151930284 17:77227863-77227885 CTTCCAGAAGGCTCTGCGGCTGG + Intergenic
1151990426 17:77570802-77570824 GGGCTAGAGGGCCCTGCGTGTGG + Intergenic
1153052115 18:909228-909250 GTGCCAGGAGATCCTGCGTGGGG + Intronic
1157478397 18:48037576-48037598 CTCACAGAAGGCTGTGCGTGGGG + Intronic
1159782414 18:72675495-72675517 TTGATAGAAGGCCCTGAGTGAGG - Intergenic
1159782449 18:72675720-72675742 TTGACAGAAGGCCCTGAGCGAGG - Intergenic
1160331783 18:77999921-77999943 CTGCAAGTGGGCCCTACGTGGGG - Intergenic
1160389173 18:78517608-78517630 GTGCCTGAAGGCCCTGCTTCCGG - Intergenic
1161433506 19:4248167-4248189 CTCCTAGAAAGACCTGCGTGGGG - Intronic
1161726999 19:5935276-5935298 CTGCCAGAAGCCCCTGGGGCTGG - Intronic
1162752048 19:12834926-12834948 GTGCCCCAAGGCCCTGCCTGGGG + Intronic
1163417013 19:17192963-17192985 CTGCCAGTAGCCCCTCCATGAGG - Exonic
1163457980 19:17420022-17420044 CTCCCAGAAGGCCATGCGGGGGG - Exonic
1164603133 19:29577196-29577218 CTTCCGGAAGGACCTGCCTGCGG - Intergenic
1164802185 19:31086609-31086631 CTTCCGGAAGGACCTGCCTGAGG + Intergenic
1165897467 19:39151429-39151451 CTGCCAAGTGGCCCTGCGTGAGG - Intronic
1167269615 19:48499607-48499629 GTGGGAGAAGGCCCGGCGTGGGG - Exonic
1167567073 19:50263302-50263324 CTTCTGGAAGGCCCTGGGTGGGG - Exonic
1167611989 19:50512146-50512168 CTGCCAGAAGGCCGTGACGGTGG + Exonic
1168399176 19:56074154-56074176 CCTCCAGAAGGACCTGCCTGAGG + Intergenic
1202676342 1_KI270711v1_random:10264-10286 GAGCCTGAAGTCCCTGCGTGAGG - Intergenic
926139991 2:10362764-10362786 CAGCCAGAAGCCCCTGCATCAGG + Intronic
927088406 2:19692035-19692057 CTGCAAGAAGGGCCTGGGTGTGG + Intergenic
927959414 2:27231505-27231527 CTTCCAGAAGGCCCTGCGCATGG + Exonic
928425965 2:31177935-31177957 CTGGCAACAGGCCCTGCATGTGG - Intronic
929559127 2:42944916-42944938 TTCCCAGAATGCCCTGCTTGTGG - Intergenic
931321389 2:61177407-61177429 CTGCCAGAAGGCCCCGCCCCCGG - Intronic
934321108 2:91972846-91972868 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
934568450 2:95353354-95353376 ATCCCAGAAGGCCCTTCATGGGG - Intronic
936234008 2:110727793-110727815 CTTCCTGAAGGACCTGCATGAGG + Intergenic
937149310 2:119674853-119674875 CTGCCAGGTGGCCCTGGCTGGGG - Intergenic
937994275 2:127681108-127681130 CCCGCAGAAGGCCCCGCGTGCGG + Intronic
938143178 2:128812826-128812848 CTGCAGGATGGCCCTGTGTGGGG - Intergenic
939694593 2:145308883-145308905 ATGCCTGAAGGACCTGCCTGAGG - Intergenic
940283638 2:152012130-152012152 CCTCCAGAAGGACCTGCCTGAGG - Intronic
942049155 2:172122533-172122555 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
943769316 2:191697963-191697985 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
944911800 2:204317815-204317837 CTGCCAGCAGGCCGTGGGTCTGG + Intergenic
947038122 2:225883312-225883334 CCTCCAGAAGGACCTGCCTGAGG - Intergenic
947503715 2:230690993-230691015 CAGCCAGCAGGCACTGCCTGGGG + Intergenic
948693948 2:239723335-239723357 CAGCCTGAAGGCCCTGGGAGCGG + Intergenic
948695183 2:239729674-239729696 CTGCCAGAAGGCCCTGGGACAGG - Intergenic
948735340 2:240000210-240000232 CCGCCTGAAGGACCTGCCTGAGG - Intronic
1169961156 20:11161654-11161676 CTGCCAGGAGGCTTTGAGTGAGG - Intergenic
1170136463 20:13079765-13079787 CTGGCAGAATGCCCTCTGTGTGG + Intronic
1170515463 20:17125196-17125218 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1171014765 20:21530245-21530267 CTGCCATAAGGGCCTGTGAGAGG - Intergenic
1172732033 20:37096235-37096257 CTCCCAGCAGGCTCTGCGCGCGG - Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174194550 20:48763782-48763804 CTGCCAGAATTCCCTCCCTGGGG - Intronic
1175252103 20:57616034-57616056 CTGAGAGGAGGCCCTGCGTCAGG - Intronic
1175843078 20:62042810-62042832 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1175883325 20:62273051-62273073 CTGCCAGAAGGGCCTGGCTCCGG + Intronic
1176388488 21:6151483-6151505 ATCCCAGAAGGCCCTCCATGGGG + Intergenic
1179734984 21:43386765-43386787 ATCCCAGAAGGCCCTCCATGGGG - Intergenic
1179889901 21:44330224-44330246 CCGGCTGCAGGCCCTGCGTGGGG - Exonic
1180309350 22:11156818-11156840 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1180547827 22:16518629-16518651 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
1181509895 22:23384520-23384542 CTGCCAGAGGGTGCTGCTTGAGG - Intergenic
1181590880 22:23884140-23884162 CTCCCAGAAGCCCCGGCATGAGG - Intronic
1182211630 22:28681740-28681762 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
1183678105 22:39311024-39311046 CTGCAAGAGGGCCCTGCTAGGGG - Intergenic
1185041463 22:48506592-48506614 CTGGCAGGGGGCCCTGCCTGAGG - Intronic
1185180900 22:49362537-49362559 CCTCCAGGAGGCCCTGCCTGCGG - Intergenic
1185337775 22:50278438-50278460 CAGCCAGCAGGACCTGCCTGGGG - Exonic
1185363476 22:50423310-50423332 CTGGCAGACGGCCCTCCCTGAGG + Intronic
949510412 3:4761989-4762011 ATTCCAGAAGGCCCTCCCTGAGG + Intronic
950182802 3:10927044-10927066 CTGGCAGAAGGTCATGGGTGAGG - Intronic
950423287 3:12911048-12911070 CTGCTGGAAGGCCCTGGGTGAGG - Intronic
951354333 3:21645707-21645729 CTGCCAACAGTCCCTGTGTGGGG + Intronic
953971813 3:47354235-47354257 CAGCCACAAGGCCCTGCTTCCGG - Intergenic
954419600 3:50411800-50411822 CTGCCAGCAGCCTCTGCCTGTGG + Intronic
954617605 3:51977550-51977572 ATGACAGCAGGCCCTGAGTGTGG - Intronic
954807835 3:53230595-53230617 CTGCCCGTAGGCCTTGCGGGTGG + Exonic
956107812 3:65839434-65839456 CTTCCTGAAGGACCTGCTTGAGG - Intronic
956139636 3:66132429-66132451 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
959652587 3:108765726-108765748 CTTCCTGAAGGACCTGCCTGAGG + Intergenic
960593743 3:119390026-119390048 TTGCCAGATGTCCCTGGGTGTGG + Intronic
964600423 3:158494894-158494916 CCTCCAAAAGGCCCTGCCTGAGG + Intronic
964645393 3:158953289-158953311 CTGCCTTAAGGCCATGCATGAGG + Intergenic
964777973 3:160300024-160300046 CTGCCAGAAGGCCATGTGACTGG - Intronic
967300408 3:188006905-188006927 CTGCCACATGGCCCTGCTTCTGG - Intergenic
968233546 3:197017941-197017963 CTGCCATGAGGCACTGCGTTTGG + Intronic
968927636 4:3558248-3558270 CTGCCAGGAGTCCCTGAGCGAGG - Intergenic
969627961 4:8317236-8317258 CCTCCAGCAGGCCCTGGGTGAGG + Intergenic
971858726 4:32077562-32077584 CTGCCTGAAGGACCGGCCTGAGG + Intergenic
973952449 4:56030223-56030245 CTTCCTGAAGGACCTGCCTGAGG + Intronic
975386360 4:73764414-73764436 TTGCCAGAAGGCCCTTAGAGGGG + Intergenic
982600541 4:157443629-157443651 CTGGCAGGTGGCCCTGCCTGGGG + Intergenic
985113917 4:186572840-186572862 GTGCCAAAAGTCCCGGCGTGAGG + Intergenic
985422809 4:189801519-189801541 CTGCCAGGAGGGCCTACATGTGG - Intergenic
985710428 5:1424680-1424702 TTGTGAGAAGGCCCTGAGTGGGG - Intronic
985893214 5:2732451-2732473 CTGCCAGTAGGACCTGAGCGGGG + Intergenic
987766399 5:22236925-22236947 CCTCCTGAAGGCCCTGCTTGAGG + Intronic
987857189 5:23435736-23435758 CTTCCTGAAGGACCTGCCTGAGG - Intergenic
988903826 5:35763933-35763955 CTGCCTTTAGGCCCTGCATGTGG - Intronic
992615630 5:78543587-78543609 CAGCCAGAAGGCCAGGCCTGGGG - Intronic
994135120 5:96277890-96277912 CAGCCAGCAGGCCATGAGTGTGG + Intergenic
1000709291 5:164550735-164550757 CTGCCTGAAGGACCTGCCTGAGG + Intergenic
1001159327 5:169300249-169300271 CTGTCAGCGGGCCCTGCGTCTGG + Intronic
1007113759 6:39328903-39328925 CTGCCAGCCTGCCCTGCCTGTGG + Intergenic
1007383553 6:41505290-41505312 CGGCCAGACGGCCCTGCTGGCGG + Intergenic
1007430094 6:41771455-41771477 CTGCCTGCAGCCCCTGCCTGAGG - Exonic
1008508427 6:52253737-52253759 CTGCCAGAATGCAATGCCTGGGG + Intergenic
1013411017 6:109883362-109883384 CTTCCTGAAGGTCCTGCCTGAGG + Intergenic
1014725167 6:124963375-124963397 CTGCAAGAAGGCCGTGTGCGAGG + Exonic
1018013670 6:159693552-159693574 CGGCCCGAAGGCCCTGCCTCCGG + Intronic
1018935126 6:168269235-168269257 CTCCCAGGAGGCCTTGGGTGAGG + Intergenic
1020260165 7:6526556-6526578 CAGCAAGGAGGCCCTGCGCGGGG + Exonic
1021937574 7:25646408-25646430 CTCCCAAAAGGCCCTGCATGAGG + Intergenic
1022524480 7:31028455-31028477 CTCCCAGAGGGGCCTGGGTGGGG + Intergenic
1022666078 7:32412073-32412095 CTTCCTGAAGGACCTGCTTGAGG + Intergenic
1023308683 7:38858905-38858927 CCTCCAGAAGGACCTGCCTGAGG - Intronic
1024269371 7:47630644-47630666 CTTCCTGAAGGGCCTGCCTGGGG - Intergenic
1027218296 7:76198222-76198244 CTGGGAGAAGGCCCTGGGAGTGG - Intergenic
1032467773 7:132157257-132157279 CTGCAACAAGGACCTGCCTGAGG - Intronic
1033784067 7:144708787-144708809 CTGCTAAAAGGACCTGCCTGAGG - Intronic
1035522569 8:286985-287007 CTGCAAAGGGGCCCTGCGTGAGG + Intergenic
1035917058 8:3636274-3636296 CCTCCTGAAGGCCCTGCCTGAGG + Intronic
1036021236 8:4848969-4848991 CTTCCTGAAGGACCTGCCTGAGG - Intronic
1038672704 8:29595348-29595370 ATTCCAGGAGTCCCTGCGTGTGG + Intergenic
1039476265 8:37840908-37840930 CTGGCAGATGGCCCTGCCAGTGG - Intronic
1040275566 8:46012018-46012040 TTCCCAGTAGTCCCTGCGTGGGG - Intergenic
1041385473 8:57297705-57297727 CTGCTAGAATGCTCTGAGTGAGG - Intergenic
1041440492 8:57890741-57890763 CTGCCTGGAGGACCTGCCTGAGG + Intergenic
1042661092 8:71155388-71155410 CTGTCACAAGGCCCTTTGTGAGG + Intergenic
1048991950 8:139765675-139765697 CTGCCAGAGGACCCTGTGTGGGG + Intronic
1049023572 8:139973743-139973765 CTCCCAGAGGGTCCTGCATGTGG - Intronic
1049373888 8:142280080-142280102 CTGCCCGAAAGCACCGCGTGTGG - Intronic
1049394294 8:142391988-142392010 CCTCCTGAAGGCCCTGCCTGAGG + Intronic
1049410431 8:142471595-142471617 CTGCTAGCAGGGCCTACGTGAGG + Intronic
1049668496 8:143859285-143859307 CCCCCGGGAGGCCCTGCGTGCGG - Exonic
1049668914 8:143860893-143860915 CCCCCGGGAGGCCCTGCGTGCGG - Exonic
1049669329 8:143862495-143862517 CCCCCGGGAGGCCCTGCGTGCGG - Exonic
1049669741 8:143864088-143864110 CCCCCGGGAGGCCCTGCGTGCGG - Exonic
1049670156 8:143865696-143865718 CCCCCGGGAGGCCCTGCGTGCGG - Exonic
1049807731 8:144548477-144548499 CAGCGAGGAGGTCCTGCGTGGGG + Exonic
1051342035 9:16120821-16120843 CTGCCAGAAGGCCTTGGGGAGGG - Intergenic
1053802495 9:41773327-41773349 CTGCCAGGAGTCCCTGAGCGAGG - Intergenic
1054142742 9:61541743-61541765 CTGCCAGGAGTCCCTGAGCGAGG + Intergenic
1054190803 9:61984673-61984695 CTGCCAGGAGTCCCTGAGCGAGG - Intergenic
1054462493 9:65472893-65472915 CTGCCAGGAGTCCCTGAGCGAGG + Intergenic
1054647570 9:67603044-67603066 CTGCCAGGAGTCCCTGAGCGAGG + Intergenic
1060141408 9:121213428-121213450 CTGCCAGAACTCCCAGCCTGTGG + Intronic
1060868367 9:127018269-127018291 CTTCCGGAAGGACCTGCCTGAGG + Intronic
1062344069 9:136106851-136106873 CTGGCTGCAGGCCCTGCCTGAGG - Intergenic
1062518832 9:136949387-136949409 CTGCCTGTCGGCCCTGCCTGTGG - Intronic
1062682288 9:137788349-137788371 CTGGCAGAAGGCGGTGCGGGTGG - Intronic
1186302151 X:8212024-8212046 CTGCAATAAGGCCGGGCGTGGGG + Intergenic
1186791284 X:13001663-13001685 CCTCCTGAAGGACCTGCGTGAGG - Intergenic
1187408278 X:19024227-19024249 CTGCCAGAAGAAGCTGCCTGAGG - Intronic
1188966700 X:36562269-36562291 CTTCCTGAAGGCCCTGCTTGAGG + Intergenic
1189387625 X:40550274-40550296 CTGACAGACGGGCCTGAGTGTGG - Intergenic
1190692580 X:52923868-52923890 CTGGCCCAAGGCCCTGCATGAGG - Intergenic
1192186511 X:68950558-68950580 CTGCCAGAAGGCACTGACTTAGG - Intergenic
1194118952 X:89937383-89937405 CTGCCATAAGCCCCTGACTGGGG + Intergenic
1195845316 X:109221260-109221282 ATGCCAGAAGACCCCGTGTGTGG - Intergenic
1199610251 X:149606652-149606674 CTGCCAGGAAGCCCTGTGTTGGG - Intronic
1200471828 Y:3594937-3594959 CTGCCATAAGCCCCTGACTGGGG + Intergenic
1201188595 Y:11427968-11427990 CTTCCTGAAGGACCTGCCTGAGG - Intergenic