ID: 1063315357

View in Genome Browser
Species Human (GRCh38)
Location 10:4999155-4999177
Sequence ACGGATAAGAAAGATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 2, 1: 0, 2: 0, 3: 15, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063315357_1063315362 10 Left 1063315357 10:4999155-4999177 CCTACCTCATCTTTCTTATCCGT 0: 2
1: 0
2: 0
3: 15
4: 249
Right 1063315362 10:4999188-4999210 CCAAACACTCACCTCCCATGTGG 0: 2
1: 1
2: 1
3: 18
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063315357 Original CRISPR ACGGATAAGAAAGATGAGGT AGG (reversed) Intronic
900738817 1:4317910-4317932 AAGGATAAGATAGATGAAGAGGG + Intergenic
901873329 1:12151479-12151501 GAGGAGGAGAAAGATGAGGTTGG - Intergenic
902729189 1:18357426-18357448 ACGGAGATGAGGGATGAGGTGGG + Intronic
903210147 1:21813511-21813533 ACAGAGAGGAAAGAGGAGGTGGG - Intronic
904406829 1:30296601-30296623 AAGGATAGGAAAAATGAGGCTGG + Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
910053773 1:83007470-83007492 ACTAATTAGAAAGATGAGTTTGG + Intergenic
910306034 1:85764910-85764932 CCAGATAAAAAACATGAGGTAGG - Intronic
911067736 1:93806666-93806688 AAGAATCAGAAAGATGAGGCTGG + Intronic
912537303 1:110384415-110384437 ACAGGTAAGGAAGATTAGGTGGG - Intronic
913175060 1:116266033-116266055 GCAGATAAGAAGGATGAGGAAGG + Intergenic
915327625 1:155088842-155088864 ACTGATAAGACAGAAAAGGTGGG + Intergenic
917148328 1:171916938-171916960 TCTGAGAAGAAATATGAGGTAGG - Intronic
919509884 1:198448616-198448638 AGGGGTACAAAAGATGAGGTTGG + Intergenic
921892989 1:220371350-220371372 AAAGATAAGACAGATGGGGTAGG + Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
923860495 1:237887834-237887856 ACTGACAAGCAAAATGAGGTAGG - Intronic
924074822 1:240322996-240323018 ACGGAAAATAAAGAGGAGGGGGG - Intronic
924427469 1:243965874-243965896 ACAGATGAGAAAGCTGAGATAGG + Intergenic
1063312576 10:4968409-4968431 ACGGATAAGAAAGATGAGGTAGG + Intronic
1063315357 10:4999155-4999177 ACGGATAAGAAAGATGAGGTAGG - Intronic
1064141537 10:12794869-12794891 ACTGATAATAAAGTTGAGGCTGG - Intronic
1064572273 10:16706247-16706269 AAGTATTAAAAAGATGAGGTTGG - Intronic
1064662910 10:17624151-17624173 AGGGAAAAGAAAGTTGAGGTAGG + Intergenic
1065515622 10:26521563-26521585 ACAGATAAGTAAGCTGAGGAAGG - Intronic
1065681353 10:28236564-28236586 ACGGAGAAAAAAAATGAGATCGG + Intronic
1065967440 10:30781274-30781296 ACTCATGAGAAAGATGATGTTGG - Intergenic
1068645146 10:59457818-59457840 GGGGATCAGAAAGATGGGGTTGG + Intergenic
1069314028 10:67075481-67075503 AGAGATAAGAAAGGTGAAGTTGG + Intronic
1071580147 10:86761828-86761850 ACAGATATGAAAAATGAGGTGGG + Intronic
1073109249 10:101050945-101050967 GAAGACAAGAAAGATGAGGTGGG - Intergenic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074877101 10:117622037-117622059 ACGGAATAGAGAGGTGAGGTTGG + Intergenic
1075690693 10:124392139-124392161 ACATATAAGAAAACTGAGGTTGG - Intergenic
1076137028 10:128052210-128052232 AGAGAAAAGAAAGATGGGGTTGG - Intronic
1078236315 11:9488037-9488059 ACTGAAAAGACAAATGAGGTAGG - Intronic
1079990827 11:27244831-27244853 CAGGATAAGAAAGATGAGAGAGG + Intergenic
1080815053 11:35747640-35747662 TCTGAGAAGAAAGTTGAGGTGGG + Intronic
1081780121 11:45704654-45704676 TGGGAGAAGAAAGAGGAGGTGGG - Intergenic
1081850304 11:46270991-46271013 ACGCAGCAGAAAGATGAAGTCGG + Intergenic
1082114405 11:48312560-48312582 ACTGATAAGAAAGATGAATTTGG + Intergenic
1085189204 11:74603231-74603253 ATGGATAATGAAGGTGAGGTGGG + Intronic
1085314652 11:75537156-75537178 ACAGATGAGAAAACTGAGGTTGG + Intergenic
1086049121 11:82568217-82568239 AAGTATAAGACAGATGAGCTAGG + Intergenic
1086051549 11:82597598-82597620 ACAAATAAGAAAGCTGAGGGAGG + Intergenic
1086161958 11:83731837-83731859 ACAGATAAGAAAACTGAGGCAGG - Intronic
1087462724 11:98465420-98465442 ACGGATTAGAGAGATGAATTAGG - Intergenic
1088355717 11:108941959-108941981 ACGGATAAGAACGTTGTGGCCGG - Intergenic
1088592001 11:111411506-111411528 AGGGATTAGAAAGTGGAGGTGGG - Intronic
1089789296 11:120931087-120931109 ACAGATAAGAAAAACGAGCTGGG + Intronic
1090157374 11:124455047-124455069 GGAGATAAGAAAGATGAGGTTGG - Intergenic
1090510871 11:127373750-127373772 AGAGATAGGAAAGATGAGGAAGG - Intergenic
1090685966 11:129119901-129119923 GAAGAGAAGAAAGATGAGGTCGG + Intronic
1090904402 11:131062605-131062627 ACGTATAAAAATGCTGAGGTCGG + Intergenic
1091094427 11:132806435-132806457 AAGCATAAGAAAGTTGATGTGGG + Intronic
1091427758 12:406241-406263 ACAGAGAAGAGGGATGAGGTTGG + Intronic
1091904045 12:4168488-4168510 ATGGATATAAAACATGAGGTAGG + Intergenic
1095135686 12:38599846-38599868 ATGGATAAAGAAGATGTGGTAGG + Intergenic
1096173386 12:49492797-49492819 AAGAAAAAGAAAGATGAGGCCGG + Intronic
1097170130 12:57108101-57108123 AAGGAGAAGGAAGATGAGTTAGG + Intronic
1097428635 12:59475732-59475754 ACCAATAAGAAGGATGTGGTTGG + Intergenic
1097633053 12:62087632-62087654 AGGGATAGGTAAGATGTGGTAGG + Intronic
1097701669 12:62826902-62826924 AGTGATAAGAAAGATAAGGATGG - Intronic
1097986544 12:65788316-65788338 ACAGATAAGAAAACTGAGGCTGG - Intergenic
1098219858 12:68257764-68257786 ATGAATAAGTAAGATGTGGTCGG - Intergenic
1099997983 12:89800065-89800087 GCTGATAAGAAAAATGAGGCAGG - Intergenic
1101863641 12:108503216-108503238 AGGAATAAGAAAGAGGAGTTGGG + Intergenic
1102310443 12:111840913-111840935 AAGTATAAAAAGGATGAGGTTGG - Intergenic
1102425536 12:112841286-112841308 ACGGATAGTTAAGATGAGGGGGG + Intronic
1102908435 12:116694835-116694857 ACGGATGACACAGAAGAGGTGGG + Intergenic
1103720559 12:122973001-122973023 ACAGATAAGGAAAGTGAGGTGGG - Intronic
1104637358 12:130446686-130446708 AGGGAGGAGAGAGATGAGGTTGG + Intronic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1108972608 13:56395968-56395990 CCTGACAAGAAAGATGAGCTTGG - Intergenic
1109328248 13:60896196-60896218 ACTGATAAGAAAAACAAGGTGGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111424662 13:88064272-88064294 CAGGATAAAAAAGATGAAGTGGG - Intergenic
1119541777 14:75443488-75443510 ACGGATTTCAAAGATGAGTTGGG - Intronic
1119913509 14:78373254-78373276 GGGAACAAGAAAGATGAGGTGGG + Intronic
1119989788 14:79183321-79183343 ACGAAACAGAAAGATGTGGTTGG - Intronic
1120565961 14:86057288-86057310 ACTGATAAGAAAGGTGAAGGAGG + Intergenic
1120936945 14:89906060-89906082 ACAGATAAGAAAACTGAGCTTGG - Intronic
1122463872 14:101917408-101917430 AGGGAAAAGAATCATGAGGTTGG + Intronic
1124375694 15:29127482-29127504 ACGGACAGGAAGGATGAAGTGGG - Intronic
1125603471 15:40927800-40927822 AAGGATGAGAAACAAGAGGTTGG - Intergenic
1125800087 15:42438084-42438106 CCGGATAAGACAGATGAGAAAGG + Intronic
1126980742 15:54239748-54239770 ACAGATAAGAATAAGGAGGTGGG - Intronic
1127100995 15:55564877-55564899 ACAGACAAGAATGATGAGATTGG - Intronic
1127660324 15:61094655-61094677 ACAGATAGGAAAGATCAGGAAGG + Intronic
1131707760 15:95016650-95016672 ACTGATCAGAAAGAAGAGGAGGG + Intergenic
1132354657 15:101162542-101162564 ACGGATAAGAGAGGAAAGGTGGG + Intergenic
1134278855 16:12800715-12800737 CTGGAGCAGAAAGATGAGGTTGG - Intronic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1135242743 16:20823521-20823543 ACTGATAATATAGATAAGGTAGG + Intronic
1135525211 16:23208901-23208923 AGGGATTAGAAAGATGAGCAGGG - Intronic
1137470943 16:48758067-48758089 ACATGTAAGAAAGAAGAGGTTGG + Intergenic
1137507145 16:49064008-49064030 ACAGATAAGAAAAATGAGGCTGG + Intergenic
1138499816 16:57433498-57433520 AGGGATAGGAAGGATGAGGATGG + Intronic
1138723354 16:59108340-59108362 ACAGAAAAGAAAAATGAGCTGGG + Intergenic
1203142019 16_KI270728v1_random:1772884-1772906 TAGGATAAGAAATATGAGGACGG - Intergenic
1144083573 17:11786406-11786428 ATGGAAAGGAGAGATGAGGTTGG + Intronic
1144583382 17:16473178-16473200 ACAGATAATGCAGATGAGGTGGG + Intronic
1146285853 17:31573788-31573810 ACAGATAAGAGAGCTGAGGCTGG + Intronic
1146933602 17:36795649-36795671 ATGGATAAGCAAAATGTGGTAGG - Intergenic
1150289558 17:63973526-63973548 AGGGAAAAGAAAGATGGGGGTGG + Intergenic
1151389722 17:73777814-73777836 ACAGAGAAGAAAACTGAGGTAGG - Intergenic
1151732264 17:75918404-75918426 ACAGATAAGACAGAGGAGCTGGG - Intronic
1153151384 18:2097865-2097887 AAAGAAAAGAAAGATGAGGTAGG + Intergenic
1153297433 18:3561118-3561140 ACGAATGAGAAAAATGAGCTGGG + Intronic
1153578358 18:6545721-6545743 ACGGCAGAGAAGGATGAGGTGGG - Intronic
1153630566 18:7065417-7065439 ACTGATAAGAAAGCTTATGTTGG + Intronic
1155021108 18:21897819-21897841 AAGGAACAGAAAGGTGAGGTAGG - Intergenic
1157655234 18:49380391-49380413 ACAGATGAGAAAACTGAGGTTGG - Intronic
1159801995 18:72912579-72912601 ACAGATCAGGAAAATGAGGTGGG - Intergenic
1163717382 19:18880021-18880043 AAGGATAAGCCAGGTGAGGTGGG - Intronic
1164901506 19:31930091-31930113 ATAGATAAGAAGGGTGAGGTAGG + Intergenic
1164936621 19:32219925-32219947 GAGGATAAGAAAGAAAAGGTGGG - Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1166158726 19:40935839-40935861 ACAGAAAAGAAGGATGAGGAAGG + Intergenic
1166751770 19:45167440-45167462 ACGTTTAAGAAAGATTAGGCCGG + Intronic
1167276519 19:48543441-48543463 AGGGATGAGCAAGATGAGGGTGG + Intergenic
1168320806 19:55508496-55508518 ACAGATAAGGAAACTGAGGTAGG + Intronic
925149870 2:1607560-1607582 AAGGACAGGAAAGATGAGGATGG + Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
929408022 2:41665597-41665619 CCTGATAAAAAAGATGAGTTTGG - Intergenic
929960506 2:46492680-46492702 AGGTATAAGAAAGAAGAGGGAGG + Intronic
930238400 2:48909669-48909691 AGGGGAAAGAAAGATGAGATGGG + Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
931394481 2:61874164-61874186 ACGGATAAGCAAACTGAGTTTGG + Intronic
932601519 2:73129901-73129923 AGGGAAGAGAAAGAGGAGGTGGG + Intronic
933211222 2:79571556-79571578 ATGGAGAAGAAAGATCAGTTAGG - Intronic
933421383 2:82050214-82050236 ATGGAGAAGTAAGATCAGGTAGG + Intergenic
935057635 2:99581482-99581504 AAAGATGAGAAAGATGAGGGAGG - Intronic
935489523 2:103699017-103699039 AAGGATAAGAAAAATGGGGAAGG - Intergenic
939144266 2:138394003-138394025 ACTGATAAGAAATAGGAGGGTGG - Intergenic
940790085 2:158022998-158023020 AAGGATAAGAAGGATGATCTGGG + Intronic
942373202 2:175308459-175308481 AGCAATAAGCAAGATGAGGTGGG - Intergenic
942502572 2:176607094-176607116 AAGGAGAAGGAAGAGGAGGTGGG + Intergenic
944653400 2:201854834-201854856 AAGAAAAAGAAAGGTGAGGTGGG - Intronic
945120533 2:206452748-206452770 ATGGCTGAGAAAGATGAGGAAGG - Intronic
945889517 2:215413569-215413591 ATGGAACAGAAAGATGAGGATGG - Intronic
946367718 2:219260004-219260026 GCGGCTAAGAAAGATGAAGATGG - Intronic
1169340087 20:4789997-4790019 AGGGATCAGCAAGATGGGGTGGG + Intronic
1173965248 20:47107757-47107779 AAGGAGAAGAAAGAAGAAGTAGG + Intronic
1174409372 20:50323703-50323725 ACAGATGAGAAAACTGAGGTTGG + Intergenic
1174441845 20:50561922-50561944 AGGGAGAAAAATGATGAGGTTGG - Intronic
1175030276 20:55946633-55946655 AGGGATAAGAACAGTGAGGTTGG - Intergenic
1175155294 20:56967287-56967309 ACGGAGAAGAAAGAGGAGGCTGG - Intergenic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1178097177 21:29228556-29228578 ACGGATAAGAAGGCTGAAGGAGG - Intronic
1182883838 22:33756563-33756585 AGGGAGAAGAAAGAACAGGTGGG + Intronic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
949607068 3:5664789-5664811 CCCTATAAGAAAGATGGGGTGGG - Intergenic
951172866 3:19562683-19562705 ATGTATATGAGAGATGAGGTGGG - Intergenic
951911652 3:27756214-27756236 ACGGAGATGAAAGAGGAGGAAGG + Intergenic
953400143 3:42606981-42607003 ACGTATCAGAAGGCTGAGGTGGG - Intronic
954182233 3:48890483-48890505 ACTTATAAGAAAGATCAGGCCGG - Intronic
954526511 3:51276556-51276578 ACAGATAGGAAAGATGACTTTGG + Intronic
956718942 3:72101254-72101276 ACAGATAAGAAAACTGAGGCTGG - Intergenic
959769733 3:110078590-110078612 ACGTATCAGAAAGATATGGTAGG - Intergenic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960568481 3:119161324-119161346 ACGGATAAGAGGGATGGGCTTGG + Intronic
961269370 3:125677606-125677628 CCACAGAAGAAAGATGAGGTTGG + Intergenic
961503473 3:127354709-127354731 ACTGATAAGAGAGAAAAGGTTGG + Intergenic
962018261 3:131467273-131467295 ATGGATAAAGAAGATGTGGTGGG - Intronic
964882511 3:161439826-161439848 ACCCACAAGAAAGATGAGGCTGG + Intergenic
965517911 3:169641717-169641739 ACAGATGAGAAAACTGAGGTTGG + Intronic
966058234 3:175723148-175723170 TCGCCTAAGAAACATGAGGTTGG + Intronic
967899949 3:194439747-194439769 ACGGATAAGTAAGCTCTGGTGGG + Intronic
969401686 4:6959893-6959915 ACTGATTTGAAGGATGAGGTGGG + Intronic
970369869 4:15395809-15395831 ACGGATGAGAAAAATGAAGCTGG + Intronic
970387434 4:15569934-15569956 ACGGCTAGGAAACATGAGGCTGG - Intronic
971818116 4:31516279-31516301 AAGGATAAGAAAAATAAGATAGG + Intergenic
974751100 4:66142365-66142387 ATAGATAAGAAAGAGGAGGAAGG - Intergenic
975654779 4:76630684-76630706 AAGGATAAGAAAGAGAATGTAGG + Intronic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
978644712 4:110916059-110916081 AGGGACAGGAAGGATGAGGTGGG + Intergenic
981031509 4:140130099-140130121 ACGGATAAGAAAGTTAACTTGGG + Intronic
981838853 4:149087793-149087815 AAGAATAAGGAAGATGATGTGGG - Intergenic
985827425 5:2203353-2203375 TAAGATAAGAAAGATGAAGTCGG + Intergenic
986077376 5:4351947-4351969 ATGGATAACAAAAATGTGGTAGG + Intergenic
988638717 5:33017158-33017180 AGAGATAAGAAATATAAGGTGGG - Intergenic
988706521 5:33731345-33731367 AGAGAAAAGAAAGATAAGGTTGG - Intronic
988737832 5:34040404-34040426 AGGGAAAAGAAAGAAGAGGAAGG + Intronic
989074035 5:37543680-37543702 AAGGAAAAAAAAGGTGAGGTTGG - Intronic
992357773 5:76003286-76003308 ACAGACTATAAAGATGAGGTGGG + Intergenic
993069081 5:83135358-83135380 TTAGATAAGAAAGATAAGGTAGG - Intronic
993071198 5:83166181-83166203 ATGGATAAGAAAAATGTGGCCGG - Intronic
995142637 5:108749627-108749649 CCGGAGGAGAAAGATGAGGTGGG - Intronic
995226314 5:109705158-109705180 AATGACAAGAAAGATGAGTTAGG - Intronic
995239153 5:109866038-109866060 AAAGATAAGAAAAATGTGGTAGG + Intronic
997023890 5:130035161-130035183 AAGAAGCAGAAAGATGAGGTAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997674415 5:135702014-135702036 ATGGATGAGAAAGATGAGCCTGG + Intergenic
998671893 5:144362832-144362854 ACTGATAAGGAAGCTGAGGCTGG - Intronic
998957682 5:147453912-147453934 AGGGATAAGAGAGAAGAGGGAGG - Intronic
999296537 5:150462959-150462981 AGGGAGAAGGGAGATGAGGTGGG + Intergenic
999594578 5:153188439-153188461 AAAAATAAAAAAGATGAGGTTGG + Intergenic
1000104946 5:158050572-158050594 ACGGGTAAGGAAGATCTGGTTGG + Intergenic
1000866510 5:166521192-166521214 AGAGATAAGCAAGAAGAGGTGGG + Intergenic
1001053215 5:168428978-168429000 ACAGATAGGAGAAATGAGGTTGG + Intronic
1002016912 5:176331665-176331687 ATGGATAAAGAAGATGTGGTAGG + Intronic
1007235615 6:40389716-40389738 ATGAATGAGAAAGATGAGGAGGG + Intergenic
1008096416 6:47343911-47343933 AAGGATGAGGGAGATGAGGTAGG - Intergenic
1011098203 6:83690723-83690745 ACATATAAGAAAAATGAGATGGG + Intronic
1011918238 6:92537276-92537298 AGGGATAACAAAGGTGAGATGGG - Intergenic
1012390129 6:98728948-98728970 AAGTAAAAGAAATATGAGGTAGG - Intergenic
1013599446 6:111690754-111690776 ACAGATAAGTAAACTGAGGTAGG + Intronic
1013778194 6:113702140-113702162 AGGAATATGAAAGATAAGGTGGG + Intergenic
1014267297 6:119294643-119294665 ACTGATAAGCAAGAGGAGATTGG + Intronic
1017266511 6:152452245-152452267 ACTGATGAGAAAAATGAGGTGGG + Intronic
1017545786 6:155449725-155449747 ACGGATGAGAAATTAGAGGTTGG + Intronic
1017889077 6:158624645-158624667 ACAGATAAGAAAACAGAGGTCGG + Intronic
1018038053 6:159898568-159898590 AGGGAAAAGGAAGAGGAGGTAGG - Intergenic
1019462655 7:1169179-1169201 AAAGATAAGAAAGATGAAGGTGG - Intergenic
1020591877 7:10149079-10149101 ACAGATAAAAAAGCTAAGGTGGG - Intergenic
1023409358 7:39874004-39874026 TGGGATAAGGAAGATGAGGAAGG - Intergenic
1024055333 7:45656856-45656878 ATGGAATAGAAAGAGGAGGTTGG + Intronic
1025043574 7:55670024-55670046 TGGGATAAGGAAGATGAGGAAGG + Intergenic
1025136494 7:56418533-56418555 TGGGATAAGGAAGATGAGGAAGG + Intergenic
1027167258 7:75843832-75843854 AGGGCTAAGAAAAATGAGGCTGG - Intronic
1028562982 7:92195903-92195925 ACAGATAAGAAAATTGAAGTTGG - Intergenic
1028629043 7:92913534-92913556 ACGTGGAAGAAAGATGAGGGGGG + Intergenic
1028657797 7:93230971-93230993 AAGGATAAGTGAGATGATGTAGG - Intergenic
1028829361 7:95310607-95310629 CCAGATAAGAAAGAAGAGGAAGG + Intronic
1031213984 7:118867336-118867358 ACAGCTAAGAAAGAGGAGGAGGG - Intergenic
1032771783 7:135066730-135066752 ATGGATAAAAAAGATGAGGGGGG + Intronic
1032890287 7:136187469-136187491 ACTGATAATAAAAATGAGTTTGG + Intergenic
1033669658 7:143478823-143478845 CCGGAAAAGAAAGGTGAGGATGG + Intergenic
1035533469 8:373571-373593 AAAGATGAGAAAGATGAGGTAGG - Intergenic
1038854030 8:31311840-31311862 TCGGATGAGAAAGATGAAGATGG - Intergenic
1040955486 8:52975701-52975723 AGGGCTAACAAAAATGAGGTGGG - Intergenic
1041940742 8:63384667-63384689 ACAGAAAAGAAAGATAAGGTAGG + Intergenic
1042552625 8:70007789-70007811 GGAGACAAGAAAGATGAGGTTGG + Intergenic
1042565877 8:70111238-70111260 ATGGATAAAAAAGAAGAGATAGG + Exonic
1043155093 8:76768935-76768957 AAAGATAAGAAAGTTGAGCTAGG + Intronic
1044255662 8:90057262-90057284 ATGTATAAGAAAGTTGAGGCCGG - Intergenic
1045311429 8:101006641-101006663 ACGGAGAGGCAAGATGTGGTAGG - Intergenic
1046625872 8:116576394-116576416 ACAGATAAGAAAATTGAGGCAGG - Intergenic
1046625973 8:116577381-116577403 ACAGATAAGAAAATTGAGGCAGG - Intergenic
1046875293 8:119248448-119248470 AAGGAGAAGTAAGATTAGGTAGG + Intergenic
1048629698 8:136228702-136228724 AAGAATAAGAAGGATGAGTTAGG - Intergenic
1049217925 8:141416200-141416222 ATGGATAAGAAAACTGAGGCTGG + Intronic
1050857726 9:10382161-10382183 ACGTATTAGAAAGATCAGTTTGG - Intronic
1051218147 9:14820888-14820910 ACAGCTCAGAAAAATGAGGTTGG - Intronic
1051859661 9:21609956-21609978 ACAGATAAGGAAGATGAGGAAGG + Intergenic
1055475159 9:76656121-76656143 ACTGATTAGAAACAAGAGGTGGG - Intronic
1055825002 9:80313232-80313254 AAGGTTAAAAAAGATGAAGTGGG - Intergenic
1060072430 9:120562005-120562027 ACAGATGAGGAAGCTGAGGTTGG - Intronic
1186168509 X:6852840-6852862 ATGGATACAAAGGATGAGGTTGG + Intergenic
1187331491 X:18344306-18344328 ACTGATAAGACAGAAGAGGAGGG - Intronic
1187468624 X:19548358-19548380 ACAGAGAAGATAGAGGAGGTAGG + Intronic
1190025419 X:46917663-46917685 TGGGGTAAGAGAGATGAGGTGGG + Intronic
1190262102 X:48803797-48803819 ACAGATAATAGAGGTGAGGTTGG - Intronic
1191109872 X:56796089-56796111 AGGGACAAGAAAGATGAAGAGGG - Intergenic
1192264483 X:69529542-69529564 ATGGATAAGGAAGGTGTGGTGGG - Intronic
1192557012 X:72098278-72098300 AGGAATAAGAAAGAGGAAGTTGG + Intergenic
1194236688 X:91393006-91393028 ACGGGTAGCAAAGATAAGGTGGG - Intergenic
1194831614 X:98630403-98630425 TCTGATAAAAAAGATGAGTTCGG - Intergenic
1194966822 X:100297598-100297620 GCAGATAAGAAAGATAAGGAGGG - Intronic
1195692571 X:107639461-107639483 CAGGATAAGAAAGATAAGGTAGG + Exonic
1195947286 X:110228781-110228803 GCGTATAAGCAAGATGAGGAGGG - Intronic
1197464080 X:126782514-126782536 TCAGATAAAAAAGATGAGGGAGG - Intergenic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1201907572 Y:19101337-19101359 ACTGATGAGAAAGATGAGAAAGG - Intergenic