ID: 1063320342

View in Genome Browser
Species Human (GRCh38)
Location 10:5046236-5046258
Sequence CCATAGGAGGAGGGAATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 1, 2: 3, 3: 34, 4: 408}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063320342_1063320352 9 Left 1063320342 10:5046236-5046258 CCCTCCATTCCCTCCTCCTATGG 0: 1
1: 1
2: 3
3: 34
4: 408
Right 1063320352 10:5046268-5046290 TTCTAAGATGGAGCGAACCGAGG No data
1063320342_1063320351 -3 Left 1063320342 10:5046236-5046258 CCCTCCATTCCCTCCTCCTATGG 0: 1
1: 1
2: 3
3: 34
4: 408
Right 1063320351 10:5046256-5046278 TGGCTGCAAGGATTCTAAGATGG No data
1063320342_1063320354 27 Left 1063320342 10:5046236-5046258 CCCTCCATTCCCTCCTCCTATGG 0: 1
1: 1
2: 3
3: 34
4: 408
Right 1063320354 10:5046286-5046308 CGAGGACCAAACTGTGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063320342 Original CRISPR CCATAGGAGGAGGGAATGGA GGG (reversed) Intronic
900501726 1:3009148-3009170 CCACAGGAGGTGGGCATGGAAGG - Intergenic
901489658 1:9590075-9590097 CCAGAGGAGGAAGGCATGGGAGG + Intronic
902660217 1:17895721-17895743 CCAAAGGAGAAGGGGATGGTGGG + Intergenic
902675331 1:18004781-18004803 ACATAGGAGGAGGTGATGGAGGG + Intergenic
902797122 1:18807182-18807204 GCACAGGAGGAGGGAAGGGAGGG + Intergenic
903133440 1:21293787-21293809 CCATTGGGGTAGTGAATGGAAGG - Intronic
904363169 1:29991629-29991651 CCAGAGGAAGAGGGAAGGGCAGG + Intergenic
904855848 1:33497711-33497733 ACTGAGGAGGAGGGAATGAATGG + Intergenic
905320027 1:37109419-37109441 CTATAGCAAGAGGGAATGTAGGG - Intergenic
906175032 1:43763755-43763777 CCATCAGAGGAGGCAATGGAGGG + Intronic
906672421 1:47666047-47666069 CCATAGGAAGAGGGAGTGTCTGG - Intergenic
908088793 1:60664705-60664727 CCATAAGAAGAGGGGATGGCAGG + Intergenic
910304105 1:85741953-85741975 CCAGAGGAGGAGGGAGGGAAGGG - Intronic
910558503 1:88564345-88564367 CCATGGCAGCAGGGAATGAAAGG + Intergenic
910965707 1:92806060-92806082 CCATTAGAGGGGGGAATTGAGGG + Intergenic
912653974 1:111469034-111469056 CCAGAGGAGGAAAGAAAGGAAGG - Intergenic
912794841 1:112686693-112686715 CAAGAGGAGGAGGGGTTGGAGGG - Intronic
916051007 1:161037161-161037183 CCTTTGGGTGAGGGAATGGATGG - Intronic
916379091 1:164188712-164188734 GGACAGGAGGAGGGAATGGGAGG - Intergenic
917024075 1:170622930-170622952 TTGTAGGAGGATGGAATGGAGGG - Intergenic
917750814 1:178051770-178051792 CAATAGGATGAGTAAATGGAAGG - Intergenic
920966251 1:210703871-210703893 CCAGAGCAGGAGGGCATAGAAGG + Intronic
921067432 1:211632766-211632788 CCATAGGAGGAGGAACAGGAAGG - Intergenic
922157795 1:223053575-223053597 CCAGGCGTGGAGGGAATGGAGGG + Intergenic
923022468 1:230175553-230175575 GCAGAGGAGGAGGGGAAGGAGGG - Intronic
923274224 1:232382973-232382995 CTATAGGAGGAAGGCATGGCTGG + Intergenic
923766849 1:236900458-236900480 CCACAGAAGGAGGAAGTGGAAGG + Exonic
924473822 1:244366535-244366557 CTACAGAAGGAGTGAATGGATGG + Intronic
1063236235 10:4119296-4119318 CCTTAGGAGGAAGCGATGGATGG - Intergenic
1063320342 10:5046236-5046258 CCATAGGAGGAGGGAATGGAGGG - Intronic
1063948308 10:11199050-11199072 CCTTAGGAGGAGGGGTTGGTAGG + Intronic
1064190126 10:13198592-13198614 GCAGAGGAGGAGGGAGTGGGAGG + Intronic
1064678599 10:17786660-17786682 GCATAGGTGGGGGGACTGGAGGG + Intronic
1066500509 10:35989124-35989146 CCTTAAGAGGAGGGAACTGAGGG + Intergenic
1067776047 10:49165601-49165623 CCAGAGGAGGAGAGAGTGTAAGG + Intronic
1067974835 10:51012495-51012517 CCATGGGTGGTTGGAATGGATGG - Intronic
1069610035 10:69766809-69766831 ACAAAGGAGGAGGGAAAGCAGGG - Intergenic
1069926045 10:71851401-71851423 CAATAGGAGGGGGCAATGGGAGG + Intergenic
1071375635 10:84999604-84999626 TCATAGCCAGAGGGAATGGAAGG - Intergenic
1071923655 10:90379989-90380011 CCATATGAGGAAGGAGTAGAGGG + Intergenic
1072268851 10:93756035-93756057 TCTGTGGAGGAGGGAATGGAGGG - Intergenic
1072430770 10:95368952-95368974 CCGTGGGAGGAAGGAAGGGAGGG - Intronic
1072724999 10:97807266-97807288 CCATAAGAGGAGGCATTTGATGG + Intergenic
1074420317 10:113302811-113302833 AGTTAGGAGGAGGGAATGGATGG - Intergenic
1074968112 10:118511299-118511321 CCTGAGGAGGAGGAAAGGGAGGG + Intergenic
1075791566 10:125087990-125088012 CCGAAGGAGGTGGGAATGGACGG - Intronic
1075903017 10:126058142-126058164 CCTTGGGAGGAGGGAAAGGAGGG - Intronic
1075934403 10:126327099-126327121 GCACATGAGGAGAGAATGGAGGG + Intronic
1075979462 10:126724310-126724332 GCAAAGGAGGAGGGAGGGGAGGG + Intergenic
1077305833 11:1868365-1868387 CCCGAGATGGAGGGAATGGAGGG - Intronic
1077644557 11:3912089-3912111 GGAAAGGAGAAGGGAATGGAAGG - Intronic
1078334918 11:10455734-10455756 TCAGAGGAGGAGGGGATGGAGGG + Intronic
1078495290 11:11811310-11811332 CCCGAGGAGCAGAGAATGGAAGG - Intergenic
1078806435 11:14710350-14710372 CCATAAGAAGAGGGACTGGGTGG - Intronic
1078843818 11:15104178-15104200 CCATAGGAGGAGTTAATTAAGGG - Intergenic
1080844434 11:36014548-36014570 CCATGGCAGGCGGGAAAGGAGGG - Intronic
1083292538 11:61697929-61697951 CCAGGGGAGGAGGAAATGGAGGG - Intronic
1083311712 11:61787155-61787177 CCAGGGCAGGAAGGAATGGAAGG + Exonic
1083730652 11:64650734-64650756 CCATGGGAAGAGGGATTGAAAGG + Intronic
1084040979 11:66542608-66542630 ACATGGGAGGAGGGAAAGGAAGG + Intronic
1084190627 11:67497164-67497186 CCAGAGGAGGTGGGGAAGGAAGG + Intronic
1086034548 11:82400830-82400852 CCTAAGGAGGGGGGCATGGAGGG + Intergenic
1086291709 11:85317766-85317788 GGGTAGGAGGAGGGAAAGGATGG + Intronic
1086584818 11:88438409-88438431 CAAAAGGAGCAGGAAATGGAAGG + Intergenic
1087238837 11:95752523-95752545 CTATAGGAGCTGAGAATGGATGG + Intergenic
1087386003 11:97469764-97469786 GCATGGGAGCATGGAATGGAGGG + Intergenic
1088142707 11:106636695-106636717 CCCTGGGAAGAGGGAATGTAGGG - Intergenic
1088767192 11:112994122-112994144 CCAAAGGAAGAGTGAATGAAAGG + Intronic
1088958005 11:114629678-114629700 ACATAGGAGAAGGGAATAAAGGG + Intergenic
1090721356 11:129476648-129476670 CAAAAGAAGGAGGGAAAGGAGGG - Intergenic
1092001763 12:5038631-5038653 CCCGTGGAGGAGGGAAGGGAAGG + Intergenic
1092426741 12:8381354-8381376 CAAGAGGAGGAGGGAAGAGAAGG - Intergenic
1092633821 12:10417482-10417504 CAATAGGAGGAGGGTATCGAAGG + Intronic
1092634867 12:10432921-10432943 CAATAGGAGGAGGGTATCGAAGG + Intronic
1092811650 12:12276326-12276348 CTATATCAGAAGGGAATGGAGGG + Intergenic
1093369099 12:18344462-18344484 CCATAGAGGGAGGGAAGGAATGG + Intronic
1094322892 12:29204758-29204780 CCAGAGCAGGAGGAAATGGGTGG + Intronic
1094357604 12:29594916-29594938 CCAAAGGAGGAAGAAAGGGAAGG + Intronic
1096220566 12:49826180-49826202 TTATAGGAGGAGGGCAAGGAGGG - Intronic
1096512901 12:52141584-52141606 ACACAGGAGAGGGGAATGGAGGG - Intergenic
1097193425 12:57231220-57231242 TCATAGGAGGAAGGAAGGAAGGG - Intronic
1097990071 12:65824945-65824967 CAAGAGGAGGAGGGAAGCGAGGG - Exonic
1098599440 12:72312977-72312999 GCATAAGAGGAGGGAAGGGAGGG - Intronic
1100389643 12:94137342-94137364 CAACAGGAGGAGGGAGTGGAAGG - Intergenic
1100660477 12:96692874-96692896 CCAAAGGAAGATGGAGTGGAAGG - Intronic
1101438039 12:104680677-104680699 CCAGAGGAGGAGGGATTGAGAGG - Intronic
1102566733 12:113802030-113802052 CCATTGGAGAAAGCAATGGAAGG - Intergenic
1103276921 12:119719664-119719686 ACCTAGGAGGAAGGAGTGGAGGG - Intronic
1104728887 12:131094363-131094385 CCTTATGAAGAGTGAATGGAAGG - Intronic
1104953019 12:132450982-132451004 GCAGAGGAGGAGGGGAGGGAGGG - Intergenic
1105255524 13:18741936-18741958 GAATGGGAGGAGGGAAAGGAAGG + Intergenic
1105344299 13:19559840-19559862 CCCTAGGAGGGGGGAGGGGAGGG + Intergenic
1105535735 13:21261734-21261756 CCCTAGGAGGGGGGAGGGGAGGG - Intergenic
1105709087 13:22988564-22988586 GCCATGGAGGAGGGAATGGAAGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1106522962 13:30514062-30514084 CCATATGAAGAGAGAGTGGATGG - Intronic
1107125120 13:36838116-36838138 CAATAGGAGGCAGGAATTGATGG + Intergenic
1109420072 13:62100269-62100291 CCCTCGCAGGAGGGAATGGGCGG - Intergenic
1110390340 13:74966126-74966148 CCATAAGAGGAGAACATGGATGG - Intergenic
1110527455 13:76555411-76555433 CCCTAAGAGGAGGGAAAGGGAGG - Intergenic
1111847855 13:93534146-93534168 CCTCAGGAGAATGGAATGGAAGG + Intronic
1112160292 13:96860018-96860040 CCCTAGGAGGAGTGGTTGGATGG - Intergenic
1112347033 13:98598423-98598445 GCACAGAAGGAGGAAATGGATGG - Intergenic
1113811093 13:113143151-113143173 GGAGAGGAGGGGGGAATGGATGG - Intronic
1114158724 14:20137724-20137746 GGATAAGAGAAGGGAATGGATGG - Intergenic
1114409807 14:22490036-22490058 CCTCAGGAGCAGAGAATGGAGGG + Intergenic
1114565959 14:23632991-23633013 CCATTAGAGTAGGGAATGGCAGG + Intronic
1114858722 14:26488323-26488345 CCTTAGGAAGAGAGAATGAATGG + Intronic
1115837579 14:37426132-37426154 CCAGAGGAGGTAGGAAGGGATGG + Intronic
1115960190 14:38827746-38827768 CCATAGGATGAGGGAAACAAGGG + Intergenic
1116711857 14:48378255-48378277 CCATAGGAGAATGGAAAGAAAGG + Intergenic
1116960507 14:50963650-50963672 GCATATGAGGACGGAAGGGATGG + Intergenic
1118865196 14:69697687-69697709 GGAGAGGAGGAAGGAATGGATGG - Intronic
1118901144 14:69986990-69987012 CCAGAGGAGGATGGAATGCTAGG - Intronic
1119410752 14:74428691-74428713 CCATGGGAGGAGGGGATTGTTGG + Intergenic
1119618692 14:76115330-76115352 CTATAGGAGCAAGGACTGGAAGG - Intergenic
1121304449 14:92897240-92897262 CCAGGGGAGGAGGTAATGGCTGG - Intergenic
1121447745 14:93988834-93988856 GCATGGGAGGAGGGGATGGGAGG + Intergenic
1121447750 14:93988847-93988869 GGATGGGAGGAGGGGATGGAAGG + Intergenic
1121447771 14:93988910-93988932 GGATTGGAGGAGGGAATGGGAGG + Intergenic
1121777793 14:96602163-96602185 ACACAGGAGGGGGGATTGGAGGG + Intergenic
1122572998 14:102720777-102720799 CCCAAGGAGGAGGGGACGGAGGG - Intronic
1122710797 14:103656106-103656128 GCATAGGGGAAGGGAAAGGAAGG + Intronic
1123887595 15:24742206-24742228 CAATTTGTGGAGGGAATGGAGGG - Intergenic
1123976185 15:25556572-25556594 CCATAGGAGGAGGGAATTCATGG - Intergenic
1125150102 15:36521427-36521449 CCATAGAAGGAAGGAAGGAAGGG + Intergenic
1125605597 15:40938145-40938167 CAGGAGGAGGAGGGAATGGCAGG + Exonic
1125612728 15:40982971-40982993 CCAAAGGAGCAGGGAAGGGCCGG - Exonic
1126195007 15:45921956-45921978 CCATAGGATGGGGAAGTGGAGGG - Intergenic
1127825486 15:62699025-62699047 CCATAGGAGGAGAGAATCATAGG + Intronic
1128702980 15:69817503-69817525 CCATGGAAGGAAGGAAGGGAGGG + Intergenic
1128984044 15:72206499-72206521 CCAGAGCAGAAGGAAATGGAGGG + Intronic
1129383817 15:75184661-75184683 CCAGAGGAGGAGGTATTGGGTGG - Intergenic
1129878188 15:78990657-78990679 CTGTAGGATGAGGGAATAGAAGG + Intronic
1130036085 15:80362870-80362892 GCATAGGCGGAGGGCATGAAAGG + Intronic
1130175305 15:81562755-81562777 CCAAAGGAGGAGGGAACAGAAGG - Intergenic
1130742586 15:86616780-86616802 CAAAAGGAGGAGGAAATTGAGGG - Intronic
1130909380 15:88260672-88260694 CCATAGGAGCAGGGCATGGTGGG - Intergenic
1131069515 15:89457009-89457031 CCATTGTAGGAGGGATAGGAAGG - Intergenic
1132041540 15:98528666-98528688 CCAGAGGAGGAGAGAACAGAAGG + Intergenic
1132594334 16:741301-741323 GCAGAGGATGAGGAAATGGACGG - Intronic
1132841782 16:1981528-1981550 CCACAGGAGGAGGGAGGAGAAGG + Exonic
1132929138 16:2449788-2449810 CCAGGGGTGGAGGGGATGGAGGG - Intronic
1133371513 16:5249018-5249040 CAAGAGGAGGAGGGAAGAGAAGG + Intergenic
1133456115 16:5943905-5943927 ACAGAGGAGGAGTGGATGGATGG - Intergenic
1134849932 16:17471031-17471053 GAAAAGGAGGAGGGAAAGGAAGG + Intergenic
1135031346 16:19041288-19041310 GCAAATTAGGAGGGAATGGATGG - Intronic
1135163852 16:20121582-20121604 CTATAGGATGGGGGAATGGATGG - Intergenic
1135828419 16:25751326-25751348 CCATAATAGGAGTGTATGGAGGG - Intronic
1135985232 16:27179151-27179173 AGATAGGAGGAGGGGAGGGAGGG + Intergenic
1137327767 16:47459656-47459678 CCATAGGAGGAGGGTCTTGGAGG - Intronic
1138288912 16:55830908-55830930 CCAGAGGTGGGGGAAATGGAAGG + Intronic
1138719359 16:59061039-59061061 CCAAAGGAGGAAGGGAAGGAAGG - Intergenic
1138862259 16:60772526-60772548 CCCAAGGGGGAAGGAATGGAAGG - Intergenic
1139218754 16:65157206-65157228 CCATAGGAGATGGCAAAGGAGGG - Intergenic
1139284290 16:65796996-65797018 CAAGAGGAGGAGGAAAGGGAAGG - Intergenic
1139834606 16:69828217-69828239 CCTTAGGAGGAGGGAAAGAAAGG - Intronic
1139972317 16:70783775-70783797 CCAGGGGAGAAGGGGATGGATGG + Intronic
1140901066 16:79368306-79368328 CCATAAGAGAAGGTAATGGCAGG + Intergenic
1141426272 16:83946599-83946621 CCATAGGAGGAGGGTGGGAAAGG - Intronic
1141552519 16:84815654-84815676 CCAGAGAAGGAGGAAATAGACGG + Intergenic
1141564889 16:84894625-84894647 CCAAAGGAAGAAGTAATGGAAGG + Intronic
1142611843 17:1112849-1112871 TCAGGGAAGGAGGGAATGGAGGG - Intronic
1142614349 17:1126036-1126058 TCAAAGGAGGAGGGAAGGAAAGG + Intronic
1143345183 17:6244025-6244047 CCACTGGAGGAGGGATGGGAGGG + Intergenic
1143347732 17:6262300-6262322 GCATAGGAGAAGGCAAAGGAGGG - Intergenic
1143519644 17:7438085-7438107 TCAGAGGAGGAGGGACAGGAAGG - Intergenic
1143664048 17:8346070-8346092 CTAGAGGAGGAGGGAGAGGAAGG + Intergenic
1143949870 17:10623989-10624011 GGATGGGAGGAGGGGATGGAGGG - Intergenic
1146446030 17:32933709-32933731 ACATGGGACCAGGGAATGGATGG - Intronic
1146533671 17:33631677-33631699 CCATAGGTGGAAGGAAATGAAGG + Intronic
1147191656 17:38741502-38741524 CTGGAGGAGGAGTGAATGGATGG - Intronic
1147255115 17:39176733-39176755 CCATGGGAGGAGGGCAAGGCAGG + Intronic
1147385282 17:40077487-40077509 CCCTGGGAGGAAGGAAAGGATGG - Exonic
1147563029 17:41520512-41520534 CCATAGGAGCTGGCTATGGAAGG - Exonic
1147565731 17:41535488-41535510 CCATGGCAGGAGGGGAGGGAAGG + Intergenic
1148051767 17:44773102-44773124 CATGAGGAGGAGGGAAGGGAGGG - Intronic
1148286419 17:46396953-46396975 CCATAGGATGAGAACATGGAAGG + Intergenic
1148308585 17:46614545-46614567 CCATAGGATGAGAACATGGAAGG + Intronic
1148780747 17:50120085-50120107 CAATAGGGGGAGGGCGTGGATGG + Intronic
1150280282 17:63926077-63926099 CCGAAGGAGGAGGGAATCCAGGG - Intergenic
1150869905 17:68895826-68895848 CCTTAGGATTAGGGAATGGGTGG - Intronic
1151326727 17:73384202-73384224 CCCTAGAAGGAGGGAAGGGCAGG + Intronic
1151350816 17:73531038-73531060 CCACAGGAGGAAGGCAGGGAAGG - Intronic
1151654625 17:75490169-75490191 CCTGGGGAGGAGGGAAGGGAAGG - Intronic
1152386708 17:79979177-79979199 CCATAGGAGCTGGGCAGGGAAGG + Intronic
1152572101 17:81125388-81125410 CCCCAGGAGGTGGGAATTGATGG + Intronic
1154435496 18:14338668-14338690 GAATGGGAGGAGGGAAAGGAAGG - Intergenic
1155218491 18:23663470-23663492 CCAGAGGAGGAGGGAACTGCTGG - Intergenic
1156227733 18:35125630-35125652 TCAGAGGAAAAGGGAATGGACGG + Intronic
1160419598 18:78735088-78735110 CCAGAGCAGGAGGGCTTGGAGGG - Intergenic
1160563146 18:79771541-79771563 CCATGGGAGGACAGCATGGAGGG - Intergenic
1160621094 18:80171238-80171260 CCACAGGAGGAGGACTTGGAGGG - Exonic
1160806193 19:993257-993279 CCCTAGGAGGAGGCAGTGGCCGG - Intronic
1160993487 19:1871326-1871348 CCGTAGCAGGAGGGACTGGACGG + Intergenic
1161357652 19:3827776-3827798 CCATGGCACCAGGGAATGGAGGG - Intronic
1161695166 19:5762858-5762880 GGATAGGTGGATGGAATGGATGG + Intronic
1163126530 19:15247198-15247220 CCAGTGAAGGAGGTAATGGAGGG + Intronic
1163228073 19:15979116-15979138 ACAGTGGAGGAGGGAATGGTGGG + Intergenic
1163833946 19:19562248-19562270 TCAGTGGAGGAGGGAAGGGATGG + Intronic
1164234971 19:23323839-23323861 GAATAGGAGGAGGAAAAGGATGG - Intronic
1166704889 19:44903254-44903276 CCAAGGGGGGAGGGAAGGGAGGG - Exonic
1166923140 19:46245613-46245635 CGCTAGGAGGAGGGGCTGGATGG - Intergenic
1167349007 19:48963467-48963489 CCATAGGTGGAGGGAGAGGAGGG - Intergenic
1167476602 19:49705059-49705081 GTACAGGAGGAGGGCATGGACGG - Exonic
1168514977 19:57003620-57003642 CAAGAGGAGGAGGGGAAGGAAGG - Intergenic
925062589 2:904877-904899 GCACAAGAGGAGAGAATGGAGGG + Intergenic
925323588 2:2997645-2997667 CCAGAGGAGGAGGAAGTGAAGGG - Intergenic
925644006 2:6017466-6017488 CCGGAGGAGGTGGAAATGGATGG - Intergenic
926405301 2:12545600-12545622 CCAGAAGAGGAGGAAATGGTGGG + Intergenic
926715610 2:15921546-15921568 CCTTAGCAGGAGGGAAGGCAGGG - Intergenic
927065008 2:19462530-19462552 TAAGAGGAGGAGGGAATGAAAGG + Intergenic
927095137 2:19742597-19742619 CCACGGGAAGAGGGAAGGGAGGG + Intergenic
929124491 2:38510891-38510913 CCATAGAAGGAAGGAATCGGTGG + Intergenic
929470745 2:42190254-42190276 CAGCAGGAGGAGGGAATGGGAGG - Intronic
929729226 2:44468998-44469020 TCATGGAAGTAGGGAATGGAAGG + Intronic
929765380 2:44839687-44839709 CCAGGGGAGGAGAAAATGGAAGG - Intergenic
929815747 2:45229971-45229993 CCATAGGAATAGGGAAAGGAAGG - Intergenic
930097772 2:47579911-47579933 CCAGAGGAGGAAAGAATGGAAGG + Intergenic
931116803 2:59174197-59174219 CCACAGGAGGAGGGAATGGAGGG + Intergenic
933031244 2:77331497-77331519 CAATAAAAGGAGAGAATGGATGG - Intronic
934575416 2:95397495-95397517 GCATGGGAGTAGGAAATGGAGGG + Intergenic
934987893 2:98900492-98900514 CCAGAGGAGGAGGGTATTGGAGG - Intronic
935211806 2:100945213-100945235 GGACAGGAGGAGGGAAAGGAAGG - Intronic
935262257 2:101365406-101365428 CCCTAGGAGGATGGAGTAGAGGG - Intronic
935512635 2:103994952-103994974 CCATTGGAGAAGGAAATTGAGGG - Intergenic
935889201 2:107657646-107657668 CCCAGGGAGGAGGGAATGAATGG - Intergenic
936855116 2:116948349-116948371 GAATAGGAGGAGGGGAAGGAGGG + Intergenic
937316827 2:120937035-120937057 CCTTGGAAGGAGGGGATGGAGGG - Intronic
938152052 2:128895441-128895463 CCAGGGGAGGAGGGCATGAACGG + Intergenic
938278446 2:130048629-130048651 GAATGGGAGGAGGGAAAGGAAGG + Intergenic
938329421 2:130439488-130439510 GAATGGGAGGAGGGAAAGGAAGG + Intergenic
938360527 2:130682015-130682037 GAATGGGAGGAGGGAAAGGAAGG - Intergenic
938436930 2:131288723-131288745 GAATGGGAGGAGGGAAAGGAAGG - Intronic
938673268 2:133604974-133604996 GCATGGGAAGAGGGAAGGGAAGG - Intergenic
938786660 2:134636050-134636072 CCATGGGGGAAGGGAAAGGAAGG - Intronic
942565068 2:177257888-177257910 CCATAGAAGGAGGTAGAGGATGG - Intronic
942607896 2:177711252-177711274 CTATGGGAGTAGGGAATGGGAGG + Intronic
942787266 2:179714143-179714165 GCATAGGAGGAGGAATAGGAAGG + Intronic
947281475 2:228460369-228460391 CCATAGGATTAGGGTGTGGATGG + Intergenic
1168810394 20:701053-701075 CCATGTGAAGAAGGAATGGAAGG + Intergenic
1168846980 20:952001-952023 GCTTCGGAGGAGGGAAGGGAGGG + Intergenic
1170168402 20:13384683-13384705 CTATAGGGGGAGTGAATGGGAGG - Intergenic
1170647016 20:18206764-18206786 CACTAGGAGGAGGGACTGTAAGG + Intergenic
1171056166 20:21908970-21908992 GCATGGGCTGAGGGAATGGAGGG + Intergenic
1171316348 20:24199157-24199179 TCCTGGGAGAAGGGAATGGAAGG + Intergenic
1172477221 20:35248075-35248097 CCTAAGGAGGTGGGAAGGGAGGG + Intronic
1172590895 20:36117124-36117146 CCACAGGAGGAGGAATTGGTGGG - Intronic
1173427376 20:42954883-42954905 GGAAAGGAGGAGGGAAGGGAGGG + Intronic
1173559546 20:43993118-43993140 TCATAGGAGGTGAGACTGGAAGG + Intronic
1173839657 20:46149138-46149160 TCGGAGGAGGAGGGAATGGCGGG + Intergenic
1175322378 20:58098367-58098389 CCATAGGGTGAGGTAAGGGAGGG - Intergenic
1175564541 20:59962691-59962713 CCACAGAAGGATGGAATGAATGG + Intronic
1176197529 20:63844346-63844368 ACCTAGGATGAGGGACTGGAGGG + Intergenic
1176841536 21:13846965-13846987 GAATGGGAGGAGGGAAAGGAAGG + Intergenic
1178479806 21:32969876-32969898 CTAGAGGAGGAAGAAATGGATGG + Intergenic
1179040994 21:37802159-37802181 CCACAGGATGAGGAAATGAATGG - Intronic
1180211387 21:46297264-46297286 GCATGGGAGGTGGGAAGGGAAGG - Intronic
1182613326 22:31567655-31567677 CTATAGGAGGAGGGAGAGAAGGG + Intronic
1183310649 22:37107766-37107788 CCTTTGGAGGAGGTAAAGGAGGG - Intronic
1183469308 22:37997191-37997213 CCTTCAGAGGAGGGGATGGAGGG - Intronic
1183696950 22:39428881-39428903 CCAGAGGCAGAGGGAAAGGAAGG - Intronic
1184333436 22:43840104-43840126 CCAGAGGAGGAAGGAAGGGGTGG + Intronic
1184333482 22:43840250-43840272 CCAGAGGACGAGGGAAGGGGTGG + Intronic
1184891818 22:47384298-47384320 CCATAAGAGCAAGGAATGCATGG + Intergenic
949421316 3:3869054-3869076 TCAGAGGAAGAGAGAATGGATGG + Intronic
949985025 3:9533805-9533827 CCTTTGGAGGAGTGACTGGAAGG + Intronic
950118146 3:10464455-10464477 CCATAGACTGTGGGAATGGAGGG - Intronic
950243496 3:11393390-11393412 CCATAAGAGGAAGGGAGGGAGGG + Intronic
950831176 3:15877854-15877876 CCTTAAGGGGAGGGAGTGGATGG + Intergenic
952138544 3:30452417-30452439 GTATAGGAGGAGGGTAAGGAAGG - Intergenic
953237222 3:41117435-41117457 CCATAGGAGAAAAAAATGGATGG + Intergenic
954284326 3:49608000-49608022 GAATGGGAGGAGGGTATGGAGGG + Intronic
955086708 3:55709731-55709753 CCAAAGGGGGAGAGAAGGGATGG + Intronic
955416041 3:58691904-58691926 CAATAAGAGGAAGGAATGAAGGG - Intergenic
955893011 3:63670172-63670194 CCATGGAAGAAGGGAAAGGAAGG + Intronic
956391054 3:68772868-68772890 CAATAGGATGAGTGAATGGATGG - Intronic
961068282 3:123895324-123895346 CCAAAGGAGAAGGAAAGGGAAGG + Intergenic
961282695 3:125776065-125776087 CAAGAGGAGGAGGGAAGAGAAGG + Intergenic
962406347 3:135103824-135103846 CCATGAGAGGAGGAAGTGGAGGG - Intronic
962680791 3:137797981-137798003 CAATAGGAGGAAAGAAAGGAAGG - Intergenic
963032619 3:140993758-140993780 CAAGAGGTAGAGGGAATGGAAGG - Intergenic
963196995 3:142543473-142543495 GCAAAGGAGGGAGGAATGGAAGG - Intronic
964559402 3:157977086-157977108 CCAAAGGAAGAGGGAAGAGATGG - Intergenic
969015033 4:4098333-4098355 CAAGAGGAGGAGGGAAGAGAAGG - Intergenic
969798095 4:9541559-9541581 CAAGAGGAGGAGGGAAGAGAAGG + Intergenic
970513230 4:16801454-16801476 CCAGAGGAGAAGGAAATTGAAGG + Intronic
972323213 4:37991804-37991826 CCACAGGAGGCTGGAATGGCTGG - Intronic
973256243 4:48116550-48116572 CCAAGTGAGGAGGGAAGGGAAGG + Intronic
975993115 4:80281262-80281284 CCATTGGTGGAGGGAAGGGATGG + Intronic
976057520 4:81085561-81085583 GATTAGGAGGAGAGAATGGAAGG - Intergenic
976195455 4:82527631-82527653 CCATGGGAAGAAGGCATGGAGGG - Intronic
976560763 4:86497885-86497907 CCATAGTGGTATGGAATGGAGGG - Intronic
979523033 4:121690040-121690062 CCAGAGGAGAAGGAAAGGGAAGG + Intronic
980896911 4:138868924-138868946 CCAAAGGAAAAGGGAAAGGAGGG + Intergenic
981075515 4:140587451-140587473 CCACAGGAGGAGGGACTCGCAGG - Intergenic
981429730 4:144645669-144645691 CCGTAGGAGGTGGGAAGGGAGGG - Intergenic
981628358 4:146787851-146787873 CGACAGGAGGAGGGGAAGGAGGG - Intronic
981762567 4:148210046-148210068 CCAGGAGAGGAGGGAATGGAAGG - Intronic
983325322 4:166247884-166247906 AGGTAGGAGGAGGTAATGGAAGG + Intergenic
983464007 4:168063724-168063746 GGGTAGGAGGAGGGAATGAAGGG + Intergenic
986863123 5:11951467-11951489 CCATAGGAGCTGGCAATGGTTGG + Intergenic
987795842 5:22625952-22625974 CCATTGGAGGAGGGGAGGCAAGG - Intronic
990258607 5:53997553-53997575 CCATAGCATGAGAGAATGAAAGG + Intronic
991588249 5:68221450-68221472 CCAAGGCAGGAGGGTATGGAAGG - Intronic
993346925 5:86795728-86795750 ACAAAGGAGGAAGGAAAGGAAGG + Intergenic
993440754 5:87954202-87954224 AAATAGTAGGAGGGAAAGGAGGG - Intergenic
993903726 5:93601697-93601719 AGAGAGGAGGAGGGTATGGAAGG + Intergenic
994968165 5:106700261-106700283 TCCTAGGAGGAGTGAATGAATGG + Intergenic
996759134 5:126969593-126969615 CCAAGGGAGGATGGCATGGATGG + Intronic
997264290 5:132486095-132486117 CCATAGGGGGAGGCAAGCGACGG - Intronic
997471195 5:134117867-134117889 ACACAGGAGGAGGAAAAGGACGG + Intronic
998382210 5:141733787-141733809 CCCTAGGAGGTGGGAATGGGGGG + Intergenic
999654957 5:153802329-153802351 GAAGAGGAGGAGGGAAAGGAAGG - Intronic
1000061397 5:157659553-157659575 ACATAGATGGAAGGAATGGAAGG - Intronic
1000541369 5:162544553-162544575 CCCTAGCAGGAGGAAATGTATGG - Intergenic
1000868541 5:166546207-166546229 CAATAGAAGGATTGAATGGATGG - Intergenic
1002422377 5:179155366-179155388 CCAGAGGAGGTGGGCTTGGAGGG - Intronic
1002616039 5:180456870-180456892 ACATATGGGGAGGGAAGGGAAGG + Intergenic
1003213501 6:4088787-4088809 CCATAGGAGGAAGGAATCATAGG - Intronic
1003768156 6:9264259-9264281 CCATAGGATGAAGGCAGGGAAGG + Intergenic
1004156766 6:13175954-13175976 CCAGGGCAGGAGGGAAAGGATGG + Intronic
1005023390 6:21439073-21439095 CTAGAGGAGGAGGGCCTGGAAGG + Intergenic
1005992369 6:30911388-30911410 ACAAAGGAGGAGGGATGGGAGGG - Intronic
1006779307 6:36621354-36621376 CCCTAGGGTGAGGCAATGGATGG + Intergenic
1007339237 6:41179784-41179806 CCAGAGGAGGATGGAGAGGATGG - Intergenic
1007369881 6:41419744-41419766 TCAGAGGAGGAGGAAATAGATGG + Intergenic
1009690997 6:67031673-67031695 CCACAGGGGGAGGGGGTGGACGG + Intergenic
1011624764 6:89273744-89273766 CCCCAGGATGAGGGAATGAATGG - Intronic
1013251705 6:108340806-108340828 TCACAGGAGGGAGGAATGGATGG + Intronic
1013462853 6:110392284-110392306 CCACAGGAGGAGATAATGTATGG - Exonic
1014159558 6:118152327-118152349 CCAGAGGTAGTGGGAATGGAGGG + Intronic
1015647264 6:135406684-135406706 CCATAGGAGTATGGATTGAATGG - Intronic
1015888167 6:137942294-137942316 CCATTGGAGGAGGAACTGCAAGG - Intergenic
1016237301 6:141883479-141883501 CCATAAGAGGAGAGAGTGGGTGG + Intergenic
1017555074 6:155555498-155555520 CAATAGAAGCAGGGAAGGGAAGG - Intergenic
1017569625 6:155730928-155730950 CCATAGGAACAGGGGAAGGATGG + Intergenic
1017569681 6:155731215-155731237 CCATAGGAACAGGGGAAGGATGG + Intergenic
1017569690 6:155731256-155731278 CCATAGGAACAGGGGAAGGATGG + Intergenic
1017569699 6:155731297-155731319 CCATAGGAACAGGGGAAGGATGG + Intergenic
1017569728 6:155731461-155731483 CCATAGGAACAGGGGAAGGATGG + Intergenic
1017569737 6:155731502-155731524 CCATAGGAACAGGGGAAGGATGG + Intergenic
1017569746 6:155731543-155731565 CCATAGGAACAGGGGAAGGATGG + Intergenic
1017569763 6:155731625-155731647 CCATAGGAACAGGGGAAGGATGG + Intergenic
1017569785 6:155731748-155731770 CTATAGGAACAGGGAAAGGATGG + Intergenic
1017569801 6:155731830-155731852 CCATAGGAACAGGGGAAGGATGG + Intergenic
1017569829 6:155731993-155732015 CCATAGGAACAGGGGAAGGATGG + Intergenic
1017569851 6:155732115-155732137 CCATAGGAACAGGGGAAGGATGG + Intergenic
1017949459 6:159123679-159123701 GCAGAGCAGGAGGGGATGGAGGG + Intergenic
1018907407 6:168083570-168083592 CCATGGGAGGAGGGCGTGAAGGG + Intergenic
1019165109 6:170093586-170093608 CAGTTTGAGGAGGGAATGGATGG + Intergenic
1019606165 7:1911304-1911326 CCTGAGGAGGAGGGAGAGGAGGG - Intronic
1019713528 7:2528222-2528244 ACACAGGAGGAGGGCAGGGATGG - Exonic
1022407992 7:30110174-30110196 CCATAGGAGGGAGGAATGGGGGG - Intronic
1022476381 7:30713317-30713339 TCATTGGAGGAGTCAATGGATGG + Intronic
1023903338 7:44502159-44502181 CCAAAGGAAGAGGGATGGGAGGG + Intergenic
1024006907 7:45231350-45231372 CCCTAGGTGGAGGGACTGGTAGG - Intergenic
1024169425 7:46768730-46768752 CAATAGGAGGAGAGTTTGGAAGG + Intergenic
1026464518 7:70642718-70642740 ACTGAGGAGGATGGAATGGAAGG - Intronic
1029073705 7:97919982-97920004 CAAGAGGAGGAGGGAAGAGAAGG - Intergenic
1029637463 7:101794486-101794508 CCCAAGGGGGAGGGAATGAAGGG + Intergenic
1029658881 7:101945830-101945852 CCATAGGTGGAGGGAAGGGAAGG - Intronic
1029686585 7:102152743-102152765 CCACAGGAGGAGACAATGGGAGG - Intronic
1029690133 7:102175674-102175696 CCACAGGAGGGGGGAATGGGTGG - Intronic
1030884820 7:114923338-114923360 CCAAAGGAAGGGGGAGTGGAGGG - Intronic
1032125877 7:129192510-129192532 CCATAGGAGCAGGGAAAGCCTGG + Intronic
1032885036 7:136128375-136128397 CCTTTGAAGGAGTGAATGGAAGG + Intergenic
1034514042 7:151559844-151559866 GAAGAGGAGGAGGGAAGGGAGGG + Intronic
1035082418 7:156227958-156227980 CAAAAGGAGGAGGGCAGGGAAGG + Intergenic
1035688041 8:1539943-1539965 CCATAGGAGCAGAGAAGAGATGG - Intronic
1036617474 8:10399747-10399769 ACATAGGAGGGTGCAATGGACGG + Intronic
1036897853 8:12650143-12650165 CAAAAGGAGGAGGGAAGAGAAGG - Intergenic
1037728874 8:21506734-21506756 CCATAGGTGGAGAGTATGGTTGG + Intergenic
1037828844 8:22176750-22176772 CCATAGCAGGAGGGGATAAAGGG - Intronic
1037917999 8:22784360-22784382 CCAGAGAAGGAAGGAAGGGAAGG + Intronic
1038050730 8:23808197-23808219 CTTTAGGAGGAAGAAATGGAGGG + Intergenic
1038232452 8:25714900-25714922 GCAGAGGAGGAAGGAAGGGAGGG - Intergenic
1038424380 8:27454880-27454902 TAATAGGAGGGGGGAAAGGAAGG - Intronic
1039052054 8:33503934-33503956 GCCTAGGAGGAAGGAATGGAAGG + Exonic
1039297068 8:36168372-36168394 CCATAGGGGTAGGGACAGGAAGG + Intergenic
1039446703 8:37638856-37638878 CCAGAGAAAGAGGGAGTGGAGGG + Intergenic
1041017124 8:53601748-53601770 CCAGAGCAGGAGGGGATGGGAGG + Intergenic
1041403354 8:57468299-57468321 ACAGAGGAGGAGAGAAAGGAGGG + Intergenic
1043972806 8:86551213-86551235 CCATTGCAGTAGGGATTGGATGG - Exonic
1044606167 8:94049890-94049912 CCATAGGAGAAGGGATTGAGAGG - Intergenic
1045251230 8:100484875-100484897 CCAGAGGATGAGAGAAAGGAAGG + Intergenic
1045756061 8:105543727-105543749 CAAAAGAAGGAAGGAATGGAGGG - Intronic
1045931994 8:107638210-107638232 CCACAAGAGCAGGGACTGGATGG - Intergenic
1046915713 8:119676083-119676105 CCATAGGAAGTGGGAAGAGAGGG - Intergenic
1047089320 8:121556262-121556284 CTATGGGAAGAGGGAATAGAGGG + Intergenic
1048296335 8:133217330-133217352 CCATGGGAGGTGTGAAGGGAGGG + Intronic
1049510047 8:143022719-143022741 CCGTAGGACTTGGGAATGGAGGG + Intronic
1049543780 8:143220251-143220273 CCTAAGGAGGAGGAAAGGGATGG - Intergenic
1050235852 9:3579196-3579218 CCAGAGGAGAATGTAATGGAGGG + Intergenic
1051072146 9:13183417-13183439 CCTTAGGAGGAGATGATGGAAGG + Exonic
1051117320 9:13710660-13710682 TCATAGGGAGAGGGAATTGAAGG - Intergenic
1051369736 9:16348195-16348217 CCATAGGAGAGGGGAATGTGGGG + Intergenic
1051731175 9:20144592-20144614 TCAGAGGAGGAGGAGATGGATGG + Intergenic
1052264413 9:26554689-26554711 ACACAGGAGCAGGGAAGGGAAGG - Intergenic
1052504812 9:29340031-29340053 CAATAGGGGGAGGGATAGGAAGG + Intergenic
1053365681 9:37520988-37521010 TCAAAGGAGGAAGGAATGAAGGG + Intronic
1053402924 9:37843557-37843579 CCATAGAAGCAGAGAAGGGAAGG + Intronic
1055674184 9:78638578-78638600 CGCTAGGAGGAGGGAAGAGAAGG + Intergenic
1055928298 9:81533054-81533076 GAAGAGGAGGAGGGAAAGGAGGG + Intergenic
1056177402 9:84048929-84048951 CCATAGCAGAAGGGAAGAGAAGG - Intergenic
1057923152 9:99116263-99116285 CCATGGGAGAAGGGAAAGGAGGG + Intronic
1058477078 9:105347138-105347160 CCATATGAGAAGGAACTGGAAGG - Intronic
1058569412 9:106324605-106324627 ACTTAGGAGGAGGGAGTGGAGGG + Intergenic
1058607182 9:106735459-106735481 CTAAAGGAGGAGGGAAGGGGTGG - Intergenic
1059343453 9:113612700-113612722 CCATCCCAGGAGGGAATGGGTGG + Intergenic
1059434223 9:114266672-114266694 CCTGGGGAGGAGGGAAGGGAAGG - Intronic
1059892730 9:118822144-118822166 CCAAGGGATGAGGGAAGGGAGGG - Intergenic
1059955983 9:119516322-119516344 CCAAAGAATGAGGGAATGGTTGG - Intronic
1060269205 9:122129039-122129061 CAATAGGATGAAGGAAAGGAAGG + Intergenic
1060668395 9:125447326-125447348 CCATAGGAGAGGGGAACAGAGGG + Intronic
1060789839 9:126478569-126478591 GCATAGAGGGAGGGAAGGGATGG + Intronic
1060828969 9:126702049-126702071 CCAGAGGAGGACGGCATGGGAGG + Intergenic
1061022795 9:128027085-128027107 CCCTGGGAGGAGGGAAGGGCAGG - Intergenic
1061227097 9:129286809-129286831 CCAGGAGGGGAGGGAATGGAGGG - Intergenic
1061453973 9:130683916-130683938 GCATGGGAGGGGGGAATGCAGGG - Intergenic
1061740256 9:132698438-132698460 TCATCTGAGGAGGGAATGTATGG - Intergenic
1061917270 9:133761851-133761873 CCAGGGGAGGAGGGAATGGCTGG - Intergenic
1062281736 9:135754939-135754961 CATAAGGAGGAGGGAAGGGAAGG - Intronic
1062358667 9:136177198-136177220 CCATCTGAGGAGGGCAAGGATGG + Intergenic
1203630518 Un_KI270750v1:69224-69246 ACACAGGATGAGGGGATGGATGG + Intergenic
1186402103 X:9269507-9269529 CCATGGGCGGTGGGCATGGAGGG + Intergenic
1186447536 X:9644386-9644408 CCAGAGGAGGAGAGGATGAAAGG + Intronic
1187563548 X:20425690-20425712 CAATTGAAGGAGGGAAAGGAGGG - Intergenic
1187683016 X:21787028-21787050 CTATGAGAGGAGGGACTGGAGGG - Intergenic
1188602820 X:31989955-31989977 CGAAAGGAGGAGGGGAGGGAGGG - Intronic
1188822683 X:34794840-34794862 TAATAGGAGGATGGGATGGAGGG - Intergenic
1189584225 X:42441518-42441540 CCATAGGAGCAGAGTAGGGAGGG - Intergenic
1189625759 X:42895230-42895252 CCAAAAGAGGAGTGAGTGGAGGG + Intergenic
1189672901 X:43430596-43430618 GCATGGGAGGAGGAAGTGGAGGG - Intergenic
1190054651 X:47174630-47174652 CCAAAGAAGGAGGGAGGGGATGG - Intronic
1192142023 X:68654045-68654067 CTATAAGAGGAGGGAACTGAGGG - Intronic
1192452163 X:71251368-71251390 CCTTAGGAGGAGGGAAGAAAAGG + Intronic
1192626977 X:72739040-72739062 TAAAGGGAGGAGGGAATGGAGGG - Intergenic
1193478259 X:81994608-81994630 CCATAGGAAGAAGGGAGGGACGG - Intergenic
1194277402 X:91902264-91902286 ACATATGAGTAGTGAATGGAGGG - Intronic
1195017102 X:100790893-100790915 GGATAAGAAGAGGGAATGGAGGG + Intergenic
1195045499 X:101051464-101051486 CTAAAGAAGAAGGGAATGGAAGG - Exonic
1196303761 X:114076567-114076589 CAATAGTATGAGGCAATGGATGG + Intergenic
1197770517 X:130086439-130086461 CCAGAGGAGGAGTGATTAGATGG + Intronic
1198006803 X:132503247-132503269 CCAGAGGAGGAGGGAAAGGAAGG + Intergenic
1198180456 X:134202889-134202911 CCATACTAGCAGGGAAGGGAAGG - Intergenic
1200594744 Y:5124361-5124383 ACATATGAGTAGTGAATGGAGGG - Intronic