ID: 1063322310

View in Genome Browser
Species Human (GRCh38)
Location 10:5061623-5061645
Sequence TCAGCTCTGGGGTTTCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063322310_1063322315 -10 Left 1063322310 10:5061623-5061645 CCTTCAAGAAACCCCAGAGCTGA 0: 1
1: 0
2: 1
3: 20
4: 254
Right 1063322315 10:5061636-5061658 CCAGAGCTGAGAGTCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063322310 Original CRISPR TCAGCTCTGGGGTTTCTTGA AGG (reversed) Intronic
902069323 1:13720450-13720472 TCAGCTCTGGGGTCGCCAGAAGG + Intronic
904710453 1:32426156-32426178 GCTGCTCTGGGGCTTCTTGCTGG + Intergenic
904883712 1:33719934-33719956 TCAGCTCTGGGGTCTCAGCAAGG + Intronic
905387334 1:37613818-37613840 GCAGCTCTGTGGTTTCCGGAGGG - Exonic
905991437 1:42340592-42340614 CTAGCATTGGGGTTTCTTGATGG - Intergenic
908139971 1:61174128-61174150 TCAGATGTGAGGTGTCTTGAAGG + Intronic
909258183 1:73451137-73451159 TCAACTCCAGGCTTTCTTGATGG + Intergenic
910819480 1:91330449-91330471 TCAGGTTTTGGGTTTCTTCATGG - Intronic
911075281 1:93867219-93867241 TCTTCTCAGGGGTATCTTGAAGG + Exonic
911134289 1:94422578-94422600 TCAGATCCTGAGTTTCTTGAGGG + Intronic
915033545 1:152904075-152904097 CCAGTTCTGGGTTTTCTGGAGGG - Intergenic
917372829 1:174314204-174314226 TCAGGTCTTGGATTTCTTCATGG + Intronic
917516873 1:175715558-175715580 TCAGCTCTTGGGACTCTTGAAGG + Intronic
917849022 1:179044078-179044100 CCAGCTCTGGTGTCTCTTCAGGG - Exonic
918041444 1:180916438-180916460 TCTGCATTGGGGTTTCTTGGGGG - Exonic
922601780 1:226861485-226861507 ACAGCTCTGGGATACCTTGATGG - Intergenic
924469434 1:244327425-244327447 TCAGATCAGTGGTTGCTTGAGGG - Intergenic
1063322310 10:5061623-5061645 TCAGCTCTGGGGTTTCTTGAAGG - Intronic
1063852542 10:10209381-10209403 GCAGCTCTGGTTTTGCTTGAAGG + Intergenic
1064478044 10:15712660-15712682 TCAGCTCAGGGGTGCCCTGATGG - Intronic
1065116902 10:22492145-22492167 CCAGTTCTGGGGTTGCATGAAGG - Intergenic
1065729363 10:28696763-28696785 TCAGACCTGGGATTTCTTGCTGG + Intergenic
1067473928 10:46554250-46554272 TAACCTTTGGGGTGTCTTGATGG - Intronic
1068012146 10:51465208-51465230 TTAGCTCAGTGGTTTCTTAAAGG - Intronic
1068103641 10:52587279-52587301 TCAGGTCTTGGGTTTCTTTATGG + Intergenic
1068461695 10:57337361-57337383 TAGGCTCTGGGATTTCTTAATGG + Intergenic
1068956124 10:62819528-62819550 TCAGACCTGGGTTTTCCTGAGGG - Intronic
1070282878 10:75062611-75062633 ACAGGTCTGTGGTTTCTGGACGG - Intergenic
1071036061 10:81247143-81247165 TCAGGTTTGGGATTTCTTCATGG - Intergenic
1071065106 10:81622778-81622800 TCAGGTTTGGGGTTTCTTCCTGG + Intergenic
1071476237 10:86027691-86027713 TCAGCTGTGGCTTTTCCTGAAGG - Intronic
1073803994 10:107075804-107075826 TCAGCTGTAGCTTTTCTTGATGG - Intronic
1074685657 10:115960258-115960280 TCTCCTCTGGAGTTTCTAGAAGG + Intergenic
1074732050 10:116389540-116389562 TCAGCTCTGGAAATTCATGAAGG - Intergenic
1074806373 10:117057187-117057209 TCAACTCTGGAGTCTATTGAAGG + Intronic
1074862273 10:117519416-117519438 TTAGCACTTGAGTTTCTTGAGGG - Intergenic
1075548214 10:123372254-123372276 TAAGCTCTAGGGTTTCATAATGG + Intergenic
1076368621 10:129937468-129937490 GCAGCGCTGGTGTGTCTTGAGGG - Intronic
1077584892 11:3443727-3443749 TCAGTTCCTGGGTGTCTTGATGG + Intergenic
1078196672 11:9142572-9142594 TTTGCTCTGGTTTTTCTTGAAGG - Intronic
1078728640 11:13955767-13955789 CCATCTCTGCGGCTTCTTGAAGG + Intergenic
1078828033 11:14950535-14950557 TCAGCTCTGCTATCTCTTGATGG + Intronic
1079526325 11:21393164-21393186 TCATCTCTGTGGCATCTTGATGG - Intronic
1081646978 11:44796900-44796922 TCAGAACTGTGGCTTCTTGAAGG + Intronic
1083127447 11:60585298-60585320 TCAGGTTTTGGGTTTCTTTATGG - Intergenic
1084581757 11:70028607-70028629 TCAGCTCTGGGGTGTGGTGGGGG - Intergenic
1084830553 11:71765559-71765581 TCAGTTCCTGGGTGTCTTGATGG - Intergenic
1085623223 11:78052834-78052856 TGAGCTCTGGGGTAACTTGATGG + Intronic
1086369418 11:86141607-86141629 TTATCTCTGGGGTTTCTCCAGGG + Intergenic
1087021557 11:93608311-93608333 TCATCTCTGGGCTACCTTGAAGG - Intergenic
1088937863 11:114421952-114421974 TCAGCTTTTGGATTTCTTTATGG + Intronic
1091052223 11:132383319-132383341 TCAGGTTTTGGGTTTCTTCATGG - Intergenic
1092321480 12:7481142-7481164 TCAGGTCTGTGGGTTCTTGGAGG - Exonic
1092412041 12:8261004-8261026 TCAGTTCCTGGGTATCTTGATGG + Intergenic
1093331009 12:17839083-17839105 TTAACTCTGATGTTTCTTGATGG + Intergenic
1093476278 12:19558220-19558242 TCAGGTTTTGGGTTTCTTCATGG + Intronic
1095526386 12:43130719-43130741 TCTGATTTGGGGTTTCTTGGGGG + Intergenic
1096189314 12:49605035-49605057 TCAGCTTGGGGGATTCTGGAGGG + Intronic
1097406822 12:59199273-59199295 TCAGATCTGGGATATTTTGATGG - Intergenic
1097789430 12:63798522-63798544 TTAGATCTGTGGTTCCTTGACGG + Intronic
1101054922 12:100902703-100902725 ACGGCCCTGGTGTTTCTTGATGG - Intronic
1101656143 12:106721796-106721818 TCAGCTCTGGGTTTTGCTGTGGG + Intronic
1102351219 12:112193758-112193780 TCCCATCTGGGGTTTCTGGATGG - Intronic
1103216859 12:119208326-119208348 AGAGCTCTGGGGTTTCTGCAGGG - Intronic
1103305178 12:119958550-119958572 CCAGCTATGGGCTATCTTGAAGG - Intergenic
1106146305 13:27052898-27052920 TTATCTCTGGGGATTCTTGCTGG - Intergenic
1106170348 13:27283303-27283325 TCCGCTCTGGGGATTCTTGGGGG + Intergenic
1109668305 13:65568233-65568255 TCAGCTCGGGGATTGCTAGAGGG + Intergenic
1110786931 13:79538982-79539004 ACAGCTCTGTGGCTGCTTGAGGG + Intronic
1110950007 13:81474093-81474115 TCAGCTGAGGGATTTCTTGCTGG + Intergenic
1111583279 13:90252480-90252502 TCTTCTCTGGGTTGTCTTGAAGG + Intergenic
1112257133 13:97844372-97844394 TCTGGTCTGGGGTTTCCTGGAGG - Intergenic
1113423394 13:110187305-110187327 TCAGCCCTGGTGTACCTTGAGGG + Exonic
1113578375 13:111410659-111410681 TCAGCTGTGGGCTTTTTTGGGGG + Intergenic
1117877401 14:60268236-60268258 TGAGCTCTGAAGTTTTTTGAGGG + Intronic
1119083830 14:71721819-71721841 GCAGCTCTGGGGCTTGTTCAAGG + Intronic
1121139263 14:91526503-91526525 TCAGCTCTGGTGTTTCTTCATGG + Intergenic
1122864203 14:104596211-104596233 TCAGGTCTGGGTTTGCTTAAAGG + Intronic
1124269694 15:28269160-28269182 CAAGCTCTGGTGTTTCTTTAAGG - Intronic
1125295278 15:38196139-38196161 CCAGGTCTGGGATTTCTTAATGG - Intergenic
1127648103 15:60977578-60977600 ACAGCTATGGGGTTTCTTTTTGG - Intronic
1128236476 15:66071002-66071024 TCAGCTGTGGTGTATCTTGGTGG + Intronic
1129007713 15:72388064-72388086 TGTGCTCTGGGGTTCCTGGAGGG - Intergenic
1131952167 15:97692743-97692765 TCAGATCTGGGGATTAATGATGG + Intergenic
1133292404 16:4731232-4731254 TCAGTTCTGTGGTTTCATAAAGG - Intronic
1133353286 16:5117205-5117227 TCAGTTCCTGGGTATCTTGATGG + Intergenic
1134339400 16:13331269-13331291 TCAGTTCTGGGGGTTCCTGAAGG + Intergenic
1135150911 16:20004863-20004885 TCAGCTCTGGCTTTTCATGCAGG - Intergenic
1135478435 16:22799396-22799418 GCTTCCCTGGGGTTTCTTGAGGG + Intergenic
1135987502 16:27194740-27194762 AAAGCTCTGGGCTGTCTTGAGGG - Intergenic
1139203273 16:65001140-65001162 TCAGCTCGGGGGTTACCTGTAGG + Intronic
1139500417 16:67359497-67359519 ACAGCTATGGGGTTTCTTTTGGG + Intronic
1139961756 16:70721962-70721984 TCAGCTCTGGGGTCTTTGGATGG + Intronic
1140932870 16:79643990-79644012 TCATCTCTGGGGTCTTTTGGGGG + Intergenic
1141192486 16:81834623-81834645 TCAGAGCTGGGGCTCCTTGAGGG + Intronic
1141396038 16:83705723-83705745 TCAGCTTTAGGGTTGTTTGAAGG - Intronic
1141494958 16:84402977-84402999 TCAGCTTTTGGATTTCTTCATGG + Intronic
1142896645 17:2983872-2983894 TCAGCTCTGATATTTCTGGAGGG + Intronic
1144261474 17:13526175-13526197 TGAGCTCTGGGGTTTGCAGATGG + Intronic
1145111963 17:20171812-20171834 GATGCTCTGGGGCTTCTTGATGG + Intronic
1149966306 17:61167743-61167765 TCAGGACTGGGGCTTCTTGTAGG + Intronic
1150289810 17:63974613-63974635 GCAGCCCTGGGGTCTCTTCAAGG - Intergenic
1151496939 17:74463544-74463566 TCAGCTCTGGAGTCTCTTCCTGG - Intergenic
1152435609 17:80274436-80274458 TCAGCTCCCGGGTTTCTTGCTGG + Intronic
1155597087 18:27500740-27500762 TCAGCTCTGAAGTCTCTCGATGG + Intergenic
1156697506 18:39784493-39784515 GCCTCTCTGGGGTTTCTTGCAGG - Intergenic
1157064898 18:44337031-44337053 TCAGGTTTTGGGTTTCTTCATGG + Intergenic
1157695850 18:49723050-49723072 TCAGCCCTGGCCTTTCTTTAAGG + Intergenic
1157698640 18:49745246-49745268 TCAGATATGAGGTTTCCTGAAGG + Intergenic
1158811357 18:61039875-61039897 CTAGCTTGGGGGTTTCTTGAGGG + Intergenic
1158887488 18:61842090-61842112 TCAGCTCTGAGTTTTATTAAGGG + Intronic
1159723877 18:71929617-71929639 TCAGCTCTAGGATTTCTTTGTGG + Intergenic
1161973837 19:7598019-7598041 TGAGCTCTGGGGACTCTTGACGG + Intronic
1162610925 19:11751246-11751268 TCAGGTTTTGGGTTTCTTCATGG + Intergenic
1163168574 19:15514904-15514926 TTAGCTCTGGGGCTGGTTGAAGG + Intronic
1163475465 19:17523493-17523515 TCAGCTGTGGGGCTGGTTGAGGG + Intronic
1163894530 19:20046255-20046277 CGAACTCTGGGTTTTCTTGAGGG + Intergenic
1164917074 19:32060496-32060518 TCAGCTTTGGGCATTCTTAATGG - Intergenic
1165122338 19:33568294-33568316 TCAGCTCTGGGCTGTGTTTAGGG - Intergenic
1165970101 19:39621340-39621362 TCAGCTCTTGGGTTCATTGATGG + Intergenic
1167267044 19:48488423-48488445 ACTGCTCTGGGGTCTCTTGGGGG - Intronic
929772257 2:44902295-44902317 TCAACTCTGGGGATGCTTGGGGG + Intergenic
931834048 2:66080628-66080650 TAATTTCTGGTGTTTCTTGAGGG - Intergenic
933153884 2:78948774-78948796 AAAGCTCTGGGGATTTTTGACGG - Intergenic
934535726 2:95131581-95131603 CCAGCTCTGGGGTTTGGGGATGG - Intronic
934545419 2:95210858-95210880 TCAGCTCAGGTGTTACTTCAAGG - Intronic
934779025 2:96957394-96957416 TCGGCTTTGGGCTTTCTGGAGGG - Intronic
935751510 2:106239022-106239044 TCAGGTTTTGGGTTTCTTCATGG - Intergenic
935783522 2:106529035-106529057 TGAGCTCTGCAGCTTCTTGAGGG + Intergenic
935911975 2:107906938-107906960 TCAGGTTTTGGGTTTCTTCATGG - Intergenic
937905698 2:127051799-127051821 CCAGCTCTGGGGTTCCTGCAGGG - Intronic
939075856 2:137602072-137602094 TCATCCCTTGGGCTTCTTGAGGG + Intronic
939373864 2:141338442-141338464 TCAGGTCAGGGGTTGCTGGAAGG + Intronic
941625529 2:167826514-167826536 TCAGTTCTTGAGTTTCTTCAAGG - Intergenic
947590400 2:231381973-231381995 TCAGCTCTGGGCTCTTTTGGTGG + Intergenic
947605314 2:231482243-231482265 TCAGCACTGGGGTTTGTGGCGGG + Intronic
948436914 2:237960083-237960105 CCAGTTCTGGGGTCACTTGATGG + Intergenic
948570505 2:238914471-238914493 GCAGCTGTCGGGTTCCTTGAGGG - Intergenic
948747533 2:240107291-240107313 TCAGGTCTGGGGCTTCATGGCGG - Intergenic
948911872 2:241008967-241008989 TCAGCTCTGGGGTGGGTTGGAGG + Intronic
1174932058 20:54826909-54826931 TCAGCTCAGGGGTTCCTACAAGG + Intergenic
1176224147 20:63985702-63985724 TCAGGTTTGGGATTTCTTCATGG - Intronic
1178063249 21:28874943-28874965 TCACCTCTGGGCTACCTTGAAGG - Exonic
1179876836 21:44273002-44273024 TCAGCACTGGGGTTTGTAGTCGG - Intergenic
1180053971 21:45347670-45347692 TCACCTCTGGCGTTTCCTGAAGG - Intergenic
1182543453 22:31058393-31058415 TCAGCTCTTGGCTTCCTTGGTGG - Intergenic
1183577087 22:38698683-38698705 TCAGTTCTGTGGTGTCTTAATGG - Intronic
1184508867 22:44920307-44920329 TCAGCACTGAGGTTTCTGGTGGG - Intronic
1184606263 22:45576461-45576483 CCAGCTCTGGGCTGTCTTGGGGG - Intronic
1184613833 22:45624352-45624374 CTTGCTCTGGGGTTTCTTGGAGG + Intergenic
1184716894 22:46287605-46287627 ACAGCTCTGGGGGCTCTTGAGGG + Intronic
1185336728 22:50274267-50274289 TCATGGCTGGGGTCTCTTGATGG - Intergenic
950472479 3:13194635-13194657 TCTCCTCTGGGGTTTCTGGGTGG - Intergenic
950537031 3:13584655-13584677 TCAGCCCTGCTCTTTCTTGAGGG - Intronic
950978768 3:17279414-17279436 TCACCTCTGAGGTCTCTTAAGGG - Intronic
952264525 3:31772573-31772595 TCAGCTCTGGGGCCCCTTGGAGG - Intronic
952517005 3:34114783-34114805 TCAGGTCTTGGATTTCTTCATGG + Intergenic
953088486 3:39698423-39698445 TCAGGTTTTGGGTTTCTTCATGG - Intergenic
954641519 3:52101833-52101855 TCAGCTTTGGTTTTTCTGGAGGG + Intronic
954644261 3:52121341-52121363 TCAGCTTTTGGGTTTGTTGGGGG - Intronic
959169459 3:102827750-102827772 TTAGCTATGGGCTTTCTTGAGGG - Intergenic
961126042 3:124418734-124418756 TCTGCACTGGTGTTTCTTTAGGG - Intronic
961430715 3:126880953-126880975 TTTGCTCTGGGGTTTCTTTGGGG - Intronic
961889596 3:130119652-130119674 TCAGTTCCTGGGTGTCTTGATGG + Intergenic
966973870 3:185068805-185068827 TCAAGTTTGGGGTTTATTGAAGG + Intergenic
967177794 3:186875207-186875229 CCAGCTATTGGGTTGCTTGATGG + Intergenic
969000086 4:3973570-3973592 TCAGTTCCTGGGTGTCTTGATGG + Intergenic
969196119 4:5565344-5565366 CCAGCTCTGGTGTTTCCTGCAGG + Exonic
969249481 4:5957535-5957557 TCCAATCTGGGGATTCTTGAGGG + Exonic
969596692 4:8153040-8153062 TAGGCTCTGGGGTTGGTTGATGG + Intronic
969753935 4:9135037-9135059 TCAGTTCCTGGGTGTCTTGATGG - Intergenic
969813825 4:9671233-9671255 TCAGTTCCTGGGTGTCTTGATGG - Intergenic
971839072 4:31809339-31809361 TCTTCTCTGGGATTTATTGAAGG + Intergenic
973327099 4:48873694-48873716 TCAGGTCTTGGATTTCTTCATGG + Intergenic
975376488 4:73652072-73652094 TCTGCTGTTGGGTTTCTTTATGG + Intergenic
975450766 4:74523526-74523548 TCAGCTCTGGGAATTCTGAATGG + Intergenic
977621653 4:99144956-99144978 TCAGCTCTGAATTTTCTTTAAGG - Intronic
977772927 4:100880962-100880984 TCAACTCTGGATTTTTTTGACGG - Intergenic
980156970 4:129118781-129118803 TCAGCTCTAGGATTTCTGTATGG - Intergenic
981267534 4:142804429-142804451 TCAACCCTGTGGTTGCTTGAGGG - Intronic
981588138 4:146326666-146326688 CCAGCTTTTAGGTTTCTTGAAGG + Intronic
983573821 4:169238603-169238625 TCAGCTCTGTGCTGTTTTGACGG + Intronic
984164284 4:176288795-176288817 TCAGTTCAGGAGTTTGTTGAGGG - Intergenic
985551274 5:534775-534797 TCCGCTCTGGGTTTTCTCGCAGG - Intergenic
987661431 5:20883269-20883291 TCAGCTGAGGGGTTTGCTGAGGG - Intergenic
987808168 5:22797285-22797307 TCAGCTCTGGTGTCTGATGAGGG - Intronic
987984490 5:25128475-25128497 TCAGATGTGGGGTTTCATCAGGG + Intergenic
988762154 5:34322056-34322078 TCAGCTGAGGGGTTTGCTGAGGG + Intergenic
988914555 5:35879420-35879442 TCAGCTCTGTGGTTTATTGTTGG + Exonic
989081688 5:37629601-37629623 TCAGCTCTAGGATTTCTTTTTGG + Intronic
989172040 5:38481510-38481532 TCAGCACTGGGCATTCTTGGAGG - Exonic
991007994 5:61850245-61850267 TTAGCTGTGGGGTTTTTTGTAGG - Intergenic
992141651 5:73803292-73803314 TCAGGACTGGGGTTTTTCGATGG + Intronic
994007382 5:94854927-94854949 TCATTTCTGTGGTTTCTGGATGG + Intronic
994324275 5:98431205-98431227 TTAGCACTGGGCTTGCTTGAAGG - Intergenic
994862745 5:105219373-105219395 AGAGCTCTTAGGTTTCTTGATGG + Intergenic
994977393 5:106827844-106827866 TCATCTCTGTGATTTCTAGAGGG - Intergenic
996298839 5:121957645-121957667 TCAGGTTTTGGGTTTCTTCATGG + Intergenic
997365521 5:133322856-133322878 TCACCTCTGGGGTTGACTGAGGG + Intronic
997406688 5:133654670-133654692 TCAGCCCTGGGAGTCCTTGAAGG - Intergenic
998762778 5:145450931-145450953 TCATCTCTGAGGCATCTTGAGGG - Intergenic
999205624 5:149845975-149845997 TTAGCTCTGGGTTTTGTTCAAGG - Intronic
999849290 5:155520811-155520833 TCAGCTTTTGGGTGTCTTCATGG + Intergenic
1002132778 5:177091693-177091715 TCAGCACTGGAGTCTCGTGATGG + Exonic
1003681575 6:8262628-8262650 GCAGCTCTGGGGGCTCTTTAAGG - Intergenic
1008847862 6:55989940-55989962 TCAGCTTTTGGATTTCTTCATGG + Intergenic
1010263944 6:73846533-73846555 TCAGCTTTTGGATTTCTTCATGG + Intergenic
1010837182 6:80603253-80603275 TCAGGTTTGGGATTTCTTCATGG + Intergenic
1014014928 6:116519055-116519077 TCTGCTCTTGAGTATCTTGAGGG + Exonic
1015382971 6:132590809-132590831 TCAGTTCTGGGATGTTTTGAAGG + Intergenic
1015409724 6:132879578-132879600 TCATCTTTGGTGTTTCTTCAAGG - Intergenic
1016839872 6:148515599-148515621 TCAGTTCCGGGGTTTCATTAGGG + Intronic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1018861545 6:167713877-167713899 TCATCTCTGGGGTTCCTCGGAGG - Intergenic
1019073737 6:169370382-169370404 ACAGCTCTGGGGGTTCCTGTGGG - Intergenic
1022193501 7:28040976-28040998 TAATCTCTGTGGTTTCTAGATGG - Intronic
1022469989 7:30676193-30676215 GCAGCTCTGGGGTGTCTGGATGG + Intronic
1023338708 7:39196855-39196877 TCCTTTCTGAGGTTTCTTGAAGG + Intronic
1025024295 7:55503790-55503812 TCAGCTCTGGTGTCTGTTGAGGG - Intronic
1026332835 7:69367835-69367857 TCAGCTCTGTGGTTTCTTTTTGG - Intergenic
1026527938 7:71172002-71172024 TCAGCTCTTGGGTTACCTGGGGG + Intronic
1030073022 7:105713750-105713772 TCCTGACTGGGGTTTCTTGAGGG - Intronic
1030291738 7:107879764-107879786 ACAGCTCTGGGTTTTGTTTAGGG - Intergenic
1030390587 7:108922439-108922461 TCAGGTTTTGGGTTTCTTCATGG + Intergenic
1030837066 7:114301612-114301634 TCAGATCTGTGATTTATTGATGG + Intronic
1031710050 7:125034256-125034278 TCAGTTCTGGGCTGTCTTGGGGG + Intergenic
1031801683 7:126254451-126254473 TCAGTTCTGGGGTTTCTATTTGG - Intergenic
1032428925 7:131844773-131844795 TTATCTCAGGGGTTTCTTGAAGG - Intergenic
1033148461 7:138891685-138891707 GCAGCTCTGGGATTTGCTGAAGG + Intronic
1033305243 7:140220529-140220551 TAAGTCCTGGGGTTTCTTGGAGG - Intergenic
1035931140 8:3781614-3781636 TCAACTATAGGGTTTCTTGATGG - Intronic
1036006757 8:4673688-4673710 CCAGCTGTGGGTTTTCTTGGGGG - Intronic
1036852397 8:12212763-12212785 TCAGTTCCTGGGTGTCTTGATGG + Intergenic
1036873765 8:12455286-12455308 TCAGTTCCTGGGTGTCTTGATGG + Intergenic
1037401488 8:18499128-18499150 TCATCTCTGGGGTTTCTAAAAGG - Intergenic
1038545148 8:28420429-28420451 CCAGCACTGGGGTTTTTTAATGG + Intronic
1038718382 8:30011931-30011953 TCAGCTCTGGGCTTTGTGCAGGG - Intergenic
1038973556 8:32666037-32666059 TCTGATCTTGTGTTTCTTGAGGG + Intronic
1039493407 8:37964501-37964523 TCAGTTCTGGGTTTTCTCAAAGG - Intronic
1039804648 8:40987706-40987728 ACAGGTCTGGGGTTCCTTGCAGG + Intergenic
1040334456 8:46408997-46409019 ACAGCTCTGGGGCTTCTGGGAGG - Intergenic
1042540858 8:69905958-69905980 TCACCTCTGGAGTCTCTTGCAGG + Intergenic
1042985792 8:74581549-74581571 TCACCTCTGGTGCTCCTTGATGG - Intergenic
1045179730 8:99767626-99767648 CCAGCTCTAGGGATTCTTTATGG - Intronic
1046212312 8:111092915-111092937 TTACTTCTGGGGTTTCTGGAGGG + Intergenic
1047701026 8:127449590-127449612 TTAGCTTTGGCGTTTGTTGATGG - Intergenic
1048256905 8:132912000-132912022 TCAGCTCTGAGCTTTCTGGTAGG + Intronic
1049690502 8:143956898-143956920 TCAGCTCTGTGGTTCCTTCCCGG + Intronic
1049985479 9:946936-946958 TCGGCTCTTTGGTATCTTGATGG - Intronic
1050474749 9:6028955-6028977 CCAGCACCAGGGTTTCTTGATGG + Intergenic
1051690913 9:19711095-19711117 TAAGGTCTGGGAATTCTTGAGGG + Intronic
1053586833 9:39467448-39467470 TCAACTCTGGGGTTTCCTACAGG + Intergenic
1054579475 9:66897782-66897804 TCAACTCTGGGGTTTCCTACAGG - Intronic
1054769281 9:69069008-69069030 GCAGCTCTGCGGTTTGCTGATGG - Intronic
1057864108 9:98665790-98665812 TCAGCTCTGGTCTTTGTTGCTGG - Intronic
1058636553 9:107043924-107043946 TCTGCACTGAGGTTTCTTGGAGG + Intergenic
1059125122 9:111677079-111677101 TCACCTCTGAGGTCTTTTGAGGG - Intergenic
1062526906 9:136981572-136981594 TCAGCCCTGGGGAGTCCTGAGGG - Exonic
1185449598 X:275374-275396 CCAGCTGTGGGGTACCTTGAGGG - Intergenic
1185789045 X:2914658-2914680 TCCTCTCCAGGGTTTCTTGAAGG + Intronic
1186806170 X:13142295-13142317 CCAGGTATGGGGTTTCTTCATGG + Intergenic
1187276177 X:17818166-17818188 TCAGCTCTGACGTTTATTGCAGG - Intronic
1188482513 X:30650032-30650054 TCACCTCTGGGTTTCTTTGATGG + Intergenic
1188545772 X:31304940-31304962 GCAGCTCTAGGGTTTCTACACGG + Intronic
1192698375 X:73442816-73442838 TCAGTGCTTGGGTTTCTGGAAGG - Intergenic
1193365945 X:80633445-80633467 TCAGCTTTTGGATTTCTTTATGG + Intergenic
1194420978 X:93672698-93672720 TCACCTCTGGGTTTTCTTTAGGG + Exonic
1195985395 X:110624978-110625000 TCAGGTTTTGGGTTTCTTCATGG - Intergenic
1197099285 X:122633055-122633077 TCAGGTTTTGGGTTTCTTCAAGG + Intergenic
1197452288 X:126634306-126634328 TCAGATTTTGGGTTTCTTCATGG + Intergenic
1197632044 X:128872522-128872544 TCAGTTCTGGGGTTACTTCTGGG - Intergenic
1198626022 X:138575411-138575433 TCAGGTCTTGGATTTCTTCATGG + Intergenic
1198798847 X:140429196-140429218 TCAGCACTGGGATTGCTGGATGG - Intergenic
1199485448 X:148342434-148342456 TCAGATTTTGGGTTTCTTTATGG - Intergenic
1199921358 X:152407523-152407545 TCAGCTTTTGGATTTCTTCATGG - Intronic
1200270974 X:154683176-154683198 TCAGCTCTGGAGTTTTCTGCAGG + Intronic