ID: 1063322310

View in Genome Browser
Species Human (GRCh38)
Location 10:5061623-5061645
Sequence TCAGCTCTGGGGTTTCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063322310_1063322315 -10 Left 1063322310 10:5061623-5061645 CCTTCAAGAAACCCCAGAGCTGA No data
Right 1063322315 10:5061636-5061658 CCAGAGCTGAGAGTCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063322310 Original CRISPR TCAGCTCTGGGGTTTCTTGA AGG (reversed) Intronic