ID: 1063322745

View in Genome Browser
Species Human (GRCh38)
Location 10:5066958-5066980
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063322744_1063322745 2 Left 1063322744 10:5066933-5066955 CCATGGAAAAAGCACTTAACAAA 0: 1
1: 1
2: 47
3: 93
4: 462
Right 1063322745 10:5066958-5066980 ATGCCCTTCTAAAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr