ID: 1063334449

View in Genome Browser
Species Human (GRCh38)
Location 10:5198504-5198526
Sequence CCAAGATTTTAACTGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063334449 Original CRISPR CCAAGATTTTAACTGGGTGC TGG (reversed) Intronic
901066890 1:6498511-6498533 CCAAGCTCTAAGCTGGGTGCTGG + Intronic
901901404 1:12366462-12366484 GTAAGATTTTATCTGGGTGAAGG + Intronic
902161161 1:14531487-14531509 CCAGCATTTTAACTGGGTCTTGG + Intergenic
907911525 1:58831322-58831344 CCAAGATGTTAACTAGTGGCTGG + Intergenic
908406916 1:63823740-63823762 TTAAGATTTTGACTGGGTGTGGG - Intronic
910963642 1:92786313-92786335 CAAAGTTTTTAGCTGGGTGGAGG - Intronic
913239003 1:116811707-116811729 TCAAGATTTTTACTGGAGGCTGG - Intergenic
913269702 1:117080921-117080943 CCAAGGTTTTTATTGGGGGCTGG + Intronic
918127225 1:181595398-181595420 CCAAGAGCTTAAATGTGTGCAGG - Intronic
919011916 1:191975683-191975705 CCAGGATTTTTACTGGGAACTGG - Intergenic
920631059 1:207652395-207652417 CCATGCTTTTACCTGAGTGCTGG - Intronic
921030393 1:211330949-211330971 CCAAGAAGATAACTGGGTGAGGG - Intronic
921155413 1:212434464-212434486 CCAAGGTTTTCACTGGGGGCTGG - Intronic
923542412 1:234898057-234898079 CCGAGATTTTAACTGAGGTCAGG + Intergenic
1063334449 10:5198504-5198526 CCAAGATTTTAACTGGGTGCTGG - Intronic
1065339834 10:24694504-24694526 ACAAGATGTTTACTGGGGGCAGG - Intronic
1069606417 10:69741585-69741607 ACAAGATTGTAATTGGGTGAGGG + Intergenic
1071329765 10:84547921-84547943 TAAAAATTTTAGCTGGGTGCTGG + Intergenic
1071426161 10:85555244-85555266 GCAAGATGTTAACTGTGTGCAGG + Intergenic
1072080269 10:92023035-92023057 CCAAAGTTTTTACTGGGGGCTGG + Intronic
1077032621 11:476392-476414 CCAGGCTTTTCACTGTGTGCCGG - Intronic
1079248030 11:18767514-18767536 GCAATATTTTAACTGGTTGCTGG + Intronic
1084152226 11:67293817-67293839 CCAATTTTTTAAATGGGTGAAGG - Intronic
1088530308 11:110800967-110800989 CGAAGATTTTAACAGGGAGTTGG + Intergenic
1093092202 12:14934804-14934826 CCCAGATTTTCACTGGGTTGTGG - Intronic
1093697038 12:22172438-22172460 CCCAGAATTTACCTGGGAGCTGG + Intronic
1095334440 12:41009222-41009244 ACAAGTTTTTAACTGGATGGTGG + Intronic
1096645917 12:53035666-53035688 ACAAAATTTTAGCTGGGTGTAGG - Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099532995 12:83809871-83809893 CCAAAATTTTAACTAAGAGCTGG - Intergenic
1104024283 12:125014593-125014615 CCAGGCTTTTTACTGGGGGCTGG + Intronic
1104162460 12:126192978-126193000 CCATGATTTTAAAATGGTGCAGG + Intergenic
1105051087 12:133051682-133051704 CCAAGGTCTTTACTGGGAGCTGG + Intronic
1105839646 13:24242838-24242860 CTAGGATTTTAAGTGGGTGAGGG - Intronic
1105883185 13:24621425-24621447 TCAAGATTTCAACTCTGTGCAGG + Intergenic
1106256878 13:28030206-28030228 CCAAGATTTTAGCTTGGGGGTGG + Intronic
1108613130 13:52103747-52103769 CCAGGATTTTTACTGGGGACTGG - Intronic
1113451693 13:110414493-110414515 CCTGGATTTTAACAGGGTTCCGG - Intronic
1116622940 14:47228892-47228914 CCAAGATTTTTGCTGGGGGCTGG + Intronic
1125814059 15:42568689-42568711 CCAGGGTTTTTACTGGGGGCTGG - Exonic
1127939608 15:63681734-63681756 CCAAGGTTTTTACTGGGGGCTGG - Intronic
1129274145 15:74434218-74434240 CCAATCTTTTTACGGGGTGCGGG - Exonic
1131508455 15:93035865-93035887 CCTAGCTATCAACTGGGTGCAGG - Intronic
1132250693 15:100333531-100333553 CCTAGCTTTTCACTGGGTGCTGG + Intronic
1132947489 16:2539749-2539771 CCATGACTGTCACTGGGTGCAGG - Intronic
1132968251 16:2671876-2671898 CCATGACTGTCACTGGGTGCAGG + Intergenic
1135942404 16:26834066-26834088 AGAAGGCTTTAACTGGGTGCTGG - Intergenic
1137229263 16:46547754-46547776 CCGAGATTTTAAGTGCGTCCTGG - Intergenic
1140378320 16:74463344-74463366 CCAAGATCTTACCTGTGTTCTGG + Exonic
1140538498 16:75733269-75733291 CCAAAATTGTAACTGAATGCAGG - Intronic
1143312954 17:6008421-6008443 CCAAGACTTCCAGTGGGTGCCGG + Intronic
1144609660 17:16699123-16699145 CCAAGATTTTAAGTGTCTTCTGG + Intronic
1144903110 17:18616431-18616453 CCAAGATTTTAAGTGTCTTCTGG - Intergenic
1144927955 17:18829552-18829574 CCAAGATTTTAAGTGTCTTCTGG + Intergenic
1145129460 17:20330322-20330344 CCAAGATTTTAAGTGTCTTCTGG + Intergenic
1145195199 17:20887318-20887340 CCAAGATTTTAAGTGTCTTCTGG - Intronic
1151548661 17:74808706-74808728 CCAAGCTTCTAGCTGGGAGCTGG - Intronic
1151872418 17:76845268-76845290 CCAAGGTTTTTACTGAGGGCTGG + Intergenic
1156845128 18:41657091-41657113 CCAAGACTTTACCTGAGTGGAGG - Intergenic
1161900178 19:7112674-7112696 CCAAATTTCTATCTGGGTGCGGG - Intronic
1164181456 19:22822553-22822575 TCACAATTTTAACTGTGTGCTGG - Intergenic
1167078481 19:47263508-47263530 CCAGGTTTTTAATTGGGGGCTGG + Intronic
1167534385 19:50040354-50040376 CCAGGGTTTTTACTGGGGGCTGG + Intronic
925948195 2:8886126-8886148 CCAAAGTTTTTACTGGGGGCTGG - Intronic
926066574 2:9844734-9844756 CCAGGCTTTTTACTAGGTGCTGG - Intronic
926612842 2:14963614-14963636 CTAAGGTTTTAATTGGGTGCTGG - Intergenic
930524287 2:52507164-52507186 CATAGATTTTAAACGGGTGCTGG + Intergenic
932380967 2:71282345-71282367 GCAAGGTTATAACTGGGTGCAGG + Intronic
934668030 2:96187647-96187669 CCAAAATTTTTATTGGGAGCTGG - Intronic
934924352 2:98371563-98371585 CAACCATTTTAACTCGGTGCTGG + Intronic
936280097 2:111131413-111131435 CCAATATTTTTAATGGATGCAGG + Intronic
936500493 2:113062446-113062468 CCATGATGTTCACTGGCTGCCGG - Exonic
938070761 2:128307007-128307029 CCCAGATTTTCACTGGGAGTTGG + Intronic
938089295 2:128420728-128420750 CAAAGGTTTTAACTAGATGCTGG + Intergenic
942410727 2:175706912-175706934 CCAAGGATTTGACTGGGGGCTGG - Intergenic
942626803 2:177909932-177909954 CCAAGATTTTGATTGGCAGCTGG - Intronic
943329734 2:186544490-186544512 GTGAGATTTTAACTGGGTGAAGG - Intergenic
944024136 2:195143349-195143371 CAGAGATTTTCACTGGGTGATGG + Intergenic
1169707831 20:8526381-8526403 CCTAGCTTTTAACTGGGACCTGG + Intronic
1176054675 20:63138133-63138155 CCAAGAGCTTATCTGGGTGGAGG - Intergenic
1182859110 22:33544020-33544042 CCAGGATTTTTATTGGGGGCTGG - Intronic
1183020195 22:35020698-35020720 TCAAGATTTGAACTGGGGTCTGG + Intergenic
1183573062 22:38668832-38668854 CCATGATTTTCACTGGGAACAGG - Intronic
950699599 3:14731625-14731647 CCAAGCTTTTTAGTGGGTACTGG + Intronic
952042612 3:29278910-29278932 TCAAGAATTGACCTGGGTGCAGG - Intergenic
953674559 3:44990689-44990711 CCAAGATTTTTACTGGGAGCTGG + Intronic
954128436 3:48546816-48546838 CCAAGGTTTTTACTGGGGGCTGG - Intronic
956153280 3:66265862-66265884 CTCAGATTTCACCTGGGTGCAGG + Intronic
957401996 3:79727735-79727757 CTGAGATTTTAAAAGGGTGCAGG - Intronic
958951753 3:100424535-100424557 CCCAGATAATGACTGGGTGCTGG + Intronic
959393295 3:105803639-105803661 CCAAAATTCTAACTGGGGGTGGG + Intronic
959581005 3:107982196-107982218 CAAAGATTTTAATTGTGTGTGGG + Intergenic
960993991 3:123329263-123329285 CCAAGATGTTAGCAGGGTGATGG + Intronic
964764037 3:160161133-160161155 CCAAGATTTTAAATGGGGCGGGG - Intergenic
965971127 3:174557977-174557999 CCAAGATTTTTACTGGGGAGTGG + Intronic
966219083 3:177532909-177532931 ACAACATTTTAACTGTGTCCTGG + Intergenic
968869172 4:3232824-3232846 CCAGGGTTTTTACTGGGGGCTGG + Intronic
968883585 4:3315025-3315047 CCAGGGTTTTTACTGGGGGCTGG - Intronic
969209830 4:5678269-5678291 CCAGAATTTTCACTGGGGGCTGG - Intronic
969972008 4:11057568-11057590 CCAACATGTTTACTGAGTGCTGG - Intergenic
970584784 4:17504813-17504835 CCAGGATGTTAACTATGTGCAGG - Intronic
971391653 4:26191725-26191747 CCAGGGTTTCAACTGGGGGCTGG + Intronic
975033540 4:69654564-69654586 CCAAGATTTTTACTTGCTACAGG + Intergenic
978718921 4:111881932-111881954 GCATTGTTTTAACTGGGTGCAGG - Intergenic
979518896 4:121643203-121643225 TCAAGATTTTTATTGGGGGCCGG + Intergenic
982223231 4:153142270-153142292 CCAAGATTTTAACTGATGGGTGG + Intergenic
984615100 4:181888361-181888383 CCTAGGGTTTATCTGGGTGCAGG - Intergenic
985663870 5:1171875-1171897 CCAAGATTCTACCTGGATCCTGG - Intergenic
991984676 5:72272459-72272481 CCAAGGTTTTTACTGAGAGCTGG - Intronic
992603053 5:78424431-78424453 CAAAGATTGTAACTTGGGGCTGG + Intronic
992626606 5:78641456-78641478 CAAATACTATAACTGGGTGCAGG + Intronic
994255824 5:97594990-97595012 GTAAGATTTTAGCTGGGTGTTGG + Intergenic
994477773 5:100291741-100291763 CCAAGAGTATCTCTGGGTGCTGG - Intergenic
995757679 5:115526950-115526972 TCAAGGTTTTTACTGGGGGCTGG - Intronic
996527368 5:124492841-124492863 CCAAGATTTTAAATGATTGCAGG + Intergenic
996656972 5:125951791-125951813 TTAAAATTTTAAGTGGGTGCTGG - Intergenic
998392957 5:141799267-141799289 CCAACCTGTGAACTGGGTGCAGG + Intergenic
1000267877 5:159655625-159655647 CTAAGAGTTTTACTGAGTGCGGG + Intergenic
1001745648 5:174090393-174090415 CCAGGGTTTTCACTGGGGGCTGG + Intronic
1003157993 6:3612486-3612508 CCAAGAATTGCACTAGGTGCTGG - Intergenic
1003459339 6:6315762-6315784 ACAAGAGTTTAACTTGGGGCTGG + Intronic
1003764650 6:9221227-9221249 CAAAGATTTTAACATGGTGATGG + Intergenic
1003768893 6:9274680-9274702 CCAAGAATTTAAGGGGGTGAGGG - Intergenic
1006518941 6:34560425-34560447 CCAAGATTTTAACTCCTTGAAGG + Intergenic
1007173557 6:39881336-39881358 CCAAGCTTTTAATTGTGTGACGG + Intronic
1008964684 6:57302401-57302423 CCATGGGTTTAACTGAGTGCTGG + Intergenic
1010063514 6:71653083-71653105 CCCAGTTTTTTACTGGGAGCTGG - Intergenic
1011807718 6:91091556-91091578 CCAAAATATAAAGTGGGTGCAGG - Intergenic
1012436391 6:99219610-99219632 TCAGGATTATAACTGGGAGCGGG - Intergenic
1016825309 6:148382780-148382802 CCAGGATTTGACATGGGTGCTGG + Intronic
1018141263 6:160839113-160839135 CTATGATTTTAGCTGGGTGTGGG - Intergenic
1019576207 7:1738886-1738908 CCAGGATTTAAACTAGGTGGGGG + Intronic
1021599153 7:22347135-22347157 CCAAAATTGTAAGTGGGGGCAGG - Intronic
1025161762 7:56667391-56667413 CCACGATTTTCCCTGTGTGCTGG - Intergenic
1026243573 7:68598247-68598269 CCAAGGTCTTTACTGGGGGCTGG + Intergenic
1026530832 7:71195919-71195941 GCAAGATTTTTATTGGGGGCTGG - Intronic
1026560523 7:71444537-71444559 CCAAAATGTTAACTGAGGGCCGG + Intronic
1026631587 7:72042509-72042531 CCAAGGTTTTCATTGGGAGCTGG + Intronic
1026636017 7:72082374-72082396 CTTAGACCTTAACTGGGTGCAGG + Intronic
1026853102 7:73737002-73737024 CCAAGATCTTGTCTAGGTGCTGG + Exonic
1027541284 7:79469147-79469169 CCAAGATTTTATCTAGGGGGAGG + Intergenic
1028791766 7:94861531-94861553 CCAAAATTTAAACTCGGTCCTGG - Intergenic
1030631277 7:111898569-111898591 CCAAGCATTTTACTGGGTACTGG - Intronic
1031451306 7:121923682-121923704 CCCTGATTTTAACTTGGTGGGGG + Intronic
1032907778 7:136391481-136391503 CCAAGGTTTTAATTGGAGGCTGG + Intergenic
1038540907 8:28389405-28389427 CCTACATTTTAACAGGGTGTGGG - Intronic
1043704656 8:83332933-83332955 CCCATGTCTTAACTGGGTGCTGG - Intergenic
1045265394 8:100614551-100614573 CCTAGATTTTAGCTTGCTGCTGG + Intronic
1046256430 8:111702787-111702809 TCATCATTTTAACTGGGTGGTGG + Intergenic
1051728122 9:20109516-20109538 CCAGGATTTTTACTGGGGGCTGG - Intergenic
1053015364 9:34658807-34658829 CCAGGCTTTGTACTGGGTGCTGG + Intronic
1053481204 9:38417798-38417820 CCAGGGTTTTTACTGGGAGCTGG + Intronic
1053520722 9:38775993-38776015 CCAACATTTTATTTGGGAGCAGG - Intergenic
1054192878 9:61999986-62000008 CCAACATTTTATTTGGGAGCAGG - Intergenic
1054645529 9:67588705-67588727 CCAACATTTTATTTGGGAGCAGG + Intergenic
1055432328 9:76256827-76256849 CCAAGATTTTCACTGTGTTAAGG - Intronic
1057012727 9:91620058-91620080 CCAGGATTTTTACTGGGGGCTGG + Intronic
1059071494 9:111142048-111142070 CCAAGATTTTTACTGGGGGCTGG + Intergenic
1187151149 X:16682734-16682756 CCAAGGTTTTTACTGGGGGCTGG - Intronic
1189020384 X:37331118-37331140 CCAGGATTTTGACTGGAGGCTGG - Intergenic
1190370973 X:49740318-49740340 CCAAGGTTTTTACTGGGGGTTGG + Intergenic
1190627384 X:52349854-52349876 CCAAGACTTTTACTTGATGCTGG - Intergenic
1190847636 X:54208957-54208979 CCATGGTTTTCACTGGGGGCTGG + Intronic
1193840912 X:86406701-86406723 GCAAGCTTTGAACTGAGTGCTGG + Intronic
1193943984 X:87709418-87709440 TCAAGATGTTACTTGGGTGCTGG - Intergenic
1194675517 X:96789266-96789288 CCAAGGTTTTTATTGGGGGCCGG + Intronic
1196282104 X:113833826-113833848 CCAAGGTTTTAACTGGGGGCTGG - Intergenic
1197355685 X:125435735-125435757 GCAAGTTTTTAACTGGGTAGTGG + Intergenic
1199520166 X:148726275-148726297 CCAAGGTTTTTACTGGGGTCTGG + Intronic
1202097481 Y:21266948-21266970 CCAAGTTTTTAACTGGTCCCAGG - Intergenic