ID: 1063336008

View in Genome Browser
Species Human (GRCh38)
Location 10:5214536-5214558
Sequence CTGAATATTCATATGGTCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063336008 Original CRISPR CTGAATATTCATATGGTCTA TGG (reversed) Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904545171 1:31264724-31264746 CTGAATAGTCCTATAGGCTACGG - Intronic
908858266 1:68453475-68453497 TTGATGATTCATATGGCCTACGG - Intergenic
909068807 1:70967857-70967879 CTGAATTTTCATATATTCTGTGG + Intronic
909695327 1:78462087-78462109 CTGTAAATCCATCTGGTCTAGGG + Intronic
911961859 1:104314679-104314701 CTGAATAATCATATTGTCAATGG - Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
912976172 1:114332263-114332285 CTGACTGTTCAGATGGTCTGTGG + Intergenic
915631973 1:157159726-157159748 CTGAAAATTCATATGGACTAAGG + Intergenic
916245650 1:162685867-162685889 CTTAATAGCCATATGGTCTTTGG - Intronic
916711195 1:167410987-167411009 CTGAATATGCTTTTGGTTTAAGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918689015 1:187457099-187457121 ATGAATATACATATGGTACAAGG - Intergenic
919655923 1:200197185-200197207 CTGAATATTAAAGTAGTCTAAGG - Intergenic
923267774 1:232331009-232331031 CTGAATGTTGATATGGTCTGTGG - Intergenic
1063336008 10:5214536-5214558 CTGAATATTCATATGGTCTATGG - Intronic
1063835091 10:10003233-10003255 CATAATATTCATAGGGCCTAGGG + Intergenic
1064517178 10:16164024-16164046 CTCAATATTCATAAGGGGTATGG + Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1071918587 10:90324641-90324663 TTGATTATTCTTATGGACTATGG + Intergenic
1071952982 10:90726184-90726206 CAAAATATACATGTGGTCTATGG + Intergenic
1073061622 10:100736935-100736957 CTGAATATTTATACGGTCGAGGG - Intronic
1073549911 10:104389105-104389127 CTGAAAATTCATAAAGTATATGG - Intronic
1073848255 10:107584468-107584490 GTTAATATTCAAATGATCTAAGG + Intergenic
1075352618 10:121737369-121737391 CTGAAATTCCATATGATCTATGG + Intergenic
1086258385 11:84907768-84907790 CTCAATATTTATATTGTCTTGGG - Intronic
1087426588 11:97995463-97995485 TTGAATATTCAGATGTTCTAGGG - Intergenic
1088314000 11:108488793-108488815 CTGAGTGTTCATATGTTCTTGGG + Intronic
1088758377 11:112906353-112906375 CTGAGTATTCATATGATGCAAGG - Intergenic
1091438196 12:490846-490868 CTGAATAGTCATATCTACTAAGG + Intronic
1092302632 12:7266722-7266744 CTGCATGTTCATATGGTCCCTGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1095091115 12:38106705-38106727 CTGTAAATTCATAAGGTCCAGGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1098058709 12:66537010-66537032 ATGAATATGCATATGGACTTTGG + Intronic
1098138213 12:67425403-67425425 CTTAATATGCATATGACCTATGG - Intergenic
1098387333 12:69933383-69933405 CTGACTATTCATATGGTGAAAGG + Intronic
1099307136 12:80971490-80971512 CTTAATTTGCATATAGTCTAAGG - Intronic
1100794925 12:98171801-98171823 CTGTATCTTCACATGGTGTAAGG - Intergenic
1101329137 12:103743321-103743343 CTGAATATTTCTAATGTCTAGGG + Intronic
1101792076 12:107936612-107936634 CTGACTAATCATAAGGTCCAAGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108360936 13:49667418-49667440 CTGAGTATTCATGAGGTTTATGG + Intronic
1108611615 13:52089313-52089335 CTGAACATTCTTATTTTCTAAGG - Exonic
1109737024 13:66499131-66499153 CTGAAAATACATAGGGTATAAGG - Intronic
1113230222 13:108205695-108205717 CTGGAAAGTCATATGGTGTAGGG - Intergenic
1113803857 13:113102092-113102114 CAGAATATTCTTATTGCCTAGGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1120989085 14:90359306-90359328 ATGAATATTTATATATTCTAGGG - Intergenic
1125872745 15:43117054-43117076 CTGCATATTAATAAGGTCTTGGG - Intronic
1126336085 15:47587677-47587699 CGCTATATTCATATGGTCTATGG - Intronic
1128297853 15:66540181-66540203 GTGAAAATTCAGATGGTCTATGG - Exonic
1129664200 15:77570328-77570350 CTGTATATTAATATGATCTGTGG - Intergenic
1131669977 15:94609137-94609159 CTTATTATCCATATGATCTAAGG + Intergenic
1132170676 15:99650853-99650875 CTGCAGATTCAGAAGGTCTAAGG - Intronic
1133466719 16:6034497-6034519 CTGCATCTTCATATGGTGGAAGG + Intronic
1138983599 16:62299803-62299825 CAGAACATTCATATGTTCTAAGG - Intergenic
1141103211 16:81212913-81212935 CTGAATCTTCAAAGGGTCTTTGG + Intergenic
1143538569 17:7556689-7556711 CCGAATGTTCATATGCTCAATGG + Intronic
1143865782 17:9922164-9922186 CCAAATATTAATATGGGCTATGG + Intronic
1149667014 17:58371993-58372015 CTGAATAATCCTATGGTCCAGGG + Intronic
1156074552 18:33257869-33257891 CTGAAATTTAATATGGCCTAAGG + Intronic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159858924 18:73623249-73623271 ATAAATATTCATATTGTATAAGG - Intergenic
1161876669 19:6917104-6917126 ATTCATATTCATATTGTCTATGG - Intronic
1163178236 19:15580558-15580580 CTGAATGTTCATTTGGTCCATGG + Intergenic
1165063728 19:33217533-33217555 CTGTTTGTTCATATGGTCTGAGG - Intronic
1165243565 19:34484676-34484698 CTGAATCTTTATATGATATAGGG + Intronic
1166912763 19:46172151-46172173 CTGAATGGTTATATAGTCTAAGG + Intergenic
925766154 2:7237579-7237601 CTGAAGGTCCATATGGTCTCAGG + Intergenic
927092380 2:19721908-19721930 TTAAATATTGATATGGGCTACGG - Intergenic
929654110 2:43712475-43712497 TTGAATATTGATATGATCTTGGG + Intronic
931166159 2:59751206-59751228 CTGGTTATGCATATGTTCTATGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938902245 2:135808186-135808208 CAGAATATTCATATTGTCATGGG - Intronic
941417092 2:165234238-165234260 CTGCAGACTAATATGGTCTATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
943104342 2:183525888-183525910 CTGAATATAAATAGGGACTATGG - Intergenic
944127066 2:196306126-196306148 CTCCATCTTCATATGGTCTAAGG - Intronic
945745419 2:213714516-213714538 CAAATTATTCATATGGTTTAGGG + Intronic
945755771 2:213844658-213844680 CTGATTATTAATAAGGTGTAGGG + Intronic
1173194066 20:40899534-40899556 CTGAATATTCAAATGTTCCCTGG + Intergenic
1175231438 20:57476031-57476053 CTACATCTTGATATGGTCTATGG - Intergenic
1175245608 20:57580214-57580236 TTGAATATTCATTTGATTTACGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175693516 20:61083691-61083713 TTGAATGTTCACATGGTTTAGGG - Intergenic
1177255181 21:18652315-18652337 CTGCATCTTCATATGGTGGAAGG - Intergenic
1180890681 22:19286164-19286186 CTGAACATTTAAATGTTCTATGG + Intronic
949419713 3:3853018-3853040 CTGAATATCCATATGATAGATGG - Intronic
956098473 3:65742464-65742486 ATGAATGTTCATATGGGCTTTGG + Intronic
957450984 3:80382035-80382057 CTGTGAATTCATGTGGTCTAGGG + Intergenic
957463104 3:80548149-80548171 CTGAGTCTTCATATGGTGGAAGG + Intergenic
957483216 3:80826122-80826144 TTAAATATTCATACTGTCTACGG + Intergenic
957541110 3:81570131-81570153 CTGAAAATTAATATTGTCTTTGG - Intronic
960002486 3:112747798-112747820 CTGAATATTAATAAGCTCTGCGG + Intronic
960574132 3:119213024-119213046 CTGAATCTTCCTATGTTATAAGG + Intronic
960631566 3:119737142-119737164 CAGAATATTAATATTCTCTATGG - Intronic
963794483 3:149617827-149617849 CTGAATATTGGTATGATTTATGG - Intronic
964865577 3:161256405-161256427 TAGAAAATTCATATGGTATAGGG + Intergenic
965243689 3:166236649-166236671 CTGTAAATTCATTTGGTCCAGGG + Intergenic
966055421 3:175681334-175681356 CTGAATGTTTATATGCTCAATGG + Intronic
968799949 4:2736129-2736151 CTGTATCTTCATATGGTAGAAGG + Intergenic
970227736 4:13877390-13877412 CAGAATATTCACATTGTCTCAGG - Intergenic
972581382 4:40398509-40398531 CAGCATATGCATATGGTCAAAGG - Intergenic
972895811 4:43619004-43619026 CTGCAAATTCATTTAGTCTAGGG - Intergenic
974097673 4:57382672-57382694 TAGAATATTCATCTGGTCTTTGG - Intergenic
974817026 4:67018551-67018573 CTGAACATTTATATGGACTCTGG - Intergenic
975961663 4:79916003-79916025 CTGAATATCCATATGGTGCGTGG - Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
977968215 4:103180745-103180767 CTGACTATTCATATCTTCTTAGG - Intronic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979855275 4:125624456-125624478 CTGAATCTCCATAAGTTCTAAGG + Intergenic
981779778 4:148414871-148414893 CTGAATATTCATGGAGTCTCTGG - Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
988012001 5:25500854-25500876 CTGAATATTCACATGGCAGAAGG - Intergenic
988350800 5:30105360-30105382 GTGAATATTTCTATAGTCTATGG - Intergenic
990079538 5:51896683-51896705 CTGAAAAGCCATCTGGTCTATGG - Intergenic
993151633 5:84170392-84170414 CTGAAACTGCACATGGTCTAAGG - Intronic
994327700 5:98468094-98468116 CTGTAAATCCATCTGGTCTAGGG - Intergenic
994409129 5:99384082-99384104 TTGATTTTTAATATGGTCTAAGG - Intergenic
994850123 5:105044170-105044192 CTGAATATTCACATAATCTCTGG - Intergenic
999416580 5:151402599-151402621 CTGTAAATCCATCTGGTCTAGGG + Intergenic
1000167496 5:158667795-158667817 CTGAATGTCCACATGGTTTATGG + Intergenic
1001259573 5:170216258-170216280 CTGAATATTCTTTTTGTCTTTGG - Intergenic
1003602207 6:7527796-7527818 GTGAAAATTCATATATTCTATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004440422 6:15645320-15645342 CTGTAAATCCATCTGGTCTAGGG - Intronic
1004653306 6:17633289-17633311 CTTGAAATTCATATGGTCTGTGG - Intronic
1005123289 6:22415457-22415479 CTTCATCTACATATGGTCTATGG - Intergenic
1005931458 6:30487973-30487995 AGGAATATTCATATGTTTTATGG + Intergenic
1009265656 6:61551530-61551552 TTGATTTTTCATATGGTATAAGG + Intergenic
1009325033 6:62338815-62338837 CTGAATATTCCTATTGGCAATGG + Intergenic
1009325344 6:62342253-62342275 CTGATAATCCATCTGGTCTAGGG - Intergenic
1010564185 6:77388937-77388959 CAGAATATCCTTATTGTCTAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012744070 6:103060808-103060830 TTATATATTCCTATGGTCTATGG - Intergenic
1012905589 6:105061068-105061090 CTGACTATTCCTATATTCTAGGG - Intronic
1013207067 6:107954964-107954986 CAAAATATGCATATGGACTAAGG + Intronic
1014618087 6:123629318-123629340 CTTAGTTTTAATATGGTCTAGGG - Intronic
1015538732 6:134293692-134293714 CTGAATATTAAGATGATTTATGG + Intronic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018117848 6:160605544-160605566 CTGAATGTTCATGAGGACTATGG + Intronic
1021029313 7:15710357-15710379 CAGAATTTTGAAATGGTCTACGG - Intergenic
1026521346 7:71120821-71120843 CTGTATATTCATAGGTTCTTGGG - Intergenic
1027602297 7:80254276-80254298 CTGTATCTTCATATGGTATAAGG - Intergenic
1027925749 7:84461069-84461091 CTTAAAATTCATAGGGTATAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1031911172 7:127518208-127518230 TTGAAAATTAATATTGTCTAAGG + Intergenic
1033774602 7:144593698-144593720 CTGAGTATTTATATGCTCAAGGG - Intronic
1038063086 8:23934079-23934101 GTTAATATTCATATAGTCTTGGG - Intergenic
1038204761 8:25455802-25455824 CTGAACATTCAGCTGGTCTCAGG - Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040685862 8:49872248-49872270 CTGAATATCCATATCGTGTATGG - Intergenic
1042573046 8:70187638-70187660 CTGAATTGTGATATGTTCTATGG - Intronic
1043109028 8:76153937-76153959 CTGAAGATTTATATTGTCTCTGG - Intergenic
1043696018 8:83218613-83218635 CTGAGAATTCATATGGTCCAGGG + Intergenic
1044105402 8:88198870-88198892 CTGAATATTCATATTTTCCCTGG - Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1047306496 8:123657075-123657097 CTCAGTATTCATGTGGTCTTGGG + Intergenic
1047894479 8:129351124-129351146 CTGAATATTCATATTAATTAAGG + Intergenic
1050164759 9:2753365-2753387 CTGTGAATTCATCTGGTCTAGGG - Intronic
1050574464 9:6978924-6978946 ATGAATATTAATAAGGTCAAAGG + Intronic
1052244229 9:26314219-26314241 CTGAATATAGAAATGGTCTTGGG + Intergenic
1052712243 9:32070833-32070855 CTGAATATTCAGCTACTCTAGGG + Intergenic
1056973974 9:91233606-91233628 CTGAATATACACATTGTTTATGG - Intronic
1057644929 9:96865091-96865113 CTGAATAATCATGTGGTAGAGGG + Intronic
1057942211 9:99295155-99295177 CTGCATACTCATATTCTCTAAGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059750747 9:117245005-117245027 CTGCATATTCATCTTCTCTACGG - Intronic
1060067843 9:120519277-120519299 CTGTATTTTCAAATGTTCTAAGG + Intronic
1060103708 9:120860780-120860802 CTGAGTTTTCAGATGGGCTAGGG + Intronic
1187336093 X:18383195-18383217 CTTAAAATTCATATTGTCTGGGG - Intergenic
1187608106 X:20908672-20908694 CTGAATAGTTATTTGATCTAAGG - Intergenic
1188788040 X:34373216-34373238 CTAATTACTCATATGGTCTCTGG - Intergenic
1189913402 X:45834022-45834044 TTGAATATGCAGATGGTCCATGG + Intergenic
1193181428 X:78462345-78462367 CTGCAAATTCATCTGGTCCAGGG + Intergenic
1194952894 X:100148069-100148091 GTGAATTTTTATATGGTGTAAGG - Intergenic
1198757482 X:139996605-139996627 CTGGATTGTCATCTGGTCTAAGG + Intergenic
1199478450 X:148272565-148272587 CTAAATTTTCATAAGATCTATGG + Intergenic
1201769256 Y:17602738-17602760 CTGGAAATTCATAAGGTCCAGGG - Intergenic
1201832298 Y:18303247-18303269 CTGGAAATTCATAAGGTCCAGGG + Intergenic