ID: 1063336038

View in Genome Browser
Species Human (GRCh38)
Location 10:5215274-5215296
Sequence CCAGTGATGGAAGTGGGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063336030_1063336038 6 Left 1063336030 10:5215245-5215267 CCTTCTAATCTCATGTTAAAATG 0: 1
1: 8
2: 215
3: 1249
4: 2574
Right 1063336038 10:5215274-5215296 CCAGTGATGGAAGTGGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063336038 Original CRISPR CCAGTGATGGAAGTGGGGTC TGG Intronic
No off target data available for this crispr