ID: 1063338145

View in Genome Browser
Species Human (GRCh38)
Location 10:5236283-5236305
Sequence CAGGTACACCAATCTAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063338145_1063338149 7 Left 1063338145 10:5236283-5236305 CCTACATTAGATTGGTGTACCTG No data
Right 1063338149 10:5236313-5236335 CAGGCAGAATGGAAACAAGTTGG No data
1063338145_1063338150 22 Left 1063338145 10:5236283-5236305 CCTACATTAGATTGGTGTACCTG No data
Right 1063338150 10:5236328-5236350 CAAGTTGGAAAACATCCTTCAGG No data
1063338145_1063338148 -4 Left 1063338145 10:5236283-5236305 CCTACATTAGATTGGTGTACCTG No data
Right 1063338148 10:5236302-5236324 CCTGAAAGTGACAGGCAGAATGG 0: 7
1: 1241
2: 2930
3: 3924
4: 2624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063338145 Original CRISPR CAGGTACACCAATCTAATGT AGG (reversed) Intergenic
No off target data available for this crispr