ID: 1063338979

View in Genome Browser
Species Human (GRCh38)
Location 10:5245050-5245072
Sequence CAGTGACAGCGGAAGGTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063338979_1063338984 -9 Left 1063338979 10:5245050-5245072 CCCCTTACCTTCCGCTGTCACTG No data
Right 1063338984 10:5245064-5245086 CTGTCACTGTAAGCTCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063338979 Original CRISPR CAGTGACAGCGGAAGGTAAG GGG (reversed) Intergenic
No off target data available for this crispr