ID: 1063338984

View in Genome Browser
Species Human (GRCh38)
Location 10:5245064-5245086
Sequence CTGTCACTGTAAGCTCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063338978_1063338984 -8 Left 1063338978 10:5245049-5245071 CCCCCTTACCTTCCGCTGTCACT No data
Right 1063338984 10:5245064-5245086 CTGTCACTGTAAGCTCCCTGTGG No data
1063338977_1063338984 -7 Left 1063338977 10:5245048-5245070 CCCCCCTTACCTTCCGCTGTCAC No data
Right 1063338984 10:5245064-5245086 CTGTCACTGTAAGCTCCCTGTGG No data
1063338979_1063338984 -9 Left 1063338979 10:5245050-5245072 CCCCTTACCTTCCGCTGTCACTG No data
Right 1063338984 10:5245064-5245086 CTGTCACTGTAAGCTCCCTGTGG No data
1063338980_1063338984 -10 Left 1063338980 10:5245051-5245073 CCCTTACCTTCCGCTGTCACTGT No data
Right 1063338984 10:5245064-5245086 CTGTCACTGTAAGCTCCCTGTGG No data
1063338974_1063338984 21 Left 1063338974 10:5245020-5245042 CCCACTCTTGTGGTGTGAGACAC No data
Right 1063338984 10:5245064-5245086 CTGTCACTGTAAGCTCCCTGTGG No data
1063338975_1063338984 20 Left 1063338975 10:5245021-5245043 CCACTCTTGTGGTGTGAGACACA No data
Right 1063338984 10:5245064-5245086 CTGTCACTGTAAGCTCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063338984 Original CRISPR CTGTCACTGTAAGCTCCCTG TGG Intergenic
No off target data available for this crispr