ID: 1063342633

View in Genome Browser
Species Human (GRCh38)
Location 10:5282509-5282531
Sequence TTGGTCTGGAGCTCAGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063342633_1063342646 21 Left 1063342633 10:5282509-5282531 CCACCCCCTGAGCTCCAGACCAA No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data
1063342633_1063342642 9 Left 1063342633 10:5282509-5282531 CCACCCCCTGAGCTCCAGACCAA No data
Right 1063342642 10:5282541-5282563 CTCCCAACTCTGCCTCCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063342633 Original CRISPR TTGGTCTGGAGCTCAGGGGG TGG (reversed) Intergenic
No off target data available for this crispr