ID: 1063342634

View in Genome Browser
Species Human (GRCh38)
Location 10:5282512-5282534
Sequence GCTTTGGTCTGGAGCTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063342634_1063342642 6 Left 1063342634 10:5282512-5282534 CCCCCTGAGCTCCAGACCAAAGC No data
Right 1063342642 10:5282541-5282563 CTCCCAACTCTGCCTCCGCTTGG No data
1063342634_1063342646 18 Left 1063342634 10:5282512-5282534 CCCCCTGAGCTCCAGACCAAAGC No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063342634 Original CRISPR GCTTTGGTCTGGAGCTCAGG GGG (reversed) Intergenic
No off target data available for this crispr