ID: 1063342641

View in Genome Browser
Species Human (GRCh38)
Location 10:5282540-5282562
Sequence CAAGCGGAGGCAGAGTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063342641_1063342650 25 Left 1063342641 10:5282540-5282562 CCTCCCAACTCTGCCTCCGCTTG No data
Right 1063342650 10:5282588-5282610 ATCCCCAAAGAACTGAAGTCAGG No data
1063342641_1063342646 -10 Left 1063342641 10:5282540-5282562 CCTCCCAACTCTGCCTCCGCTTG No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063342641 Original CRISPR CAAGCGGAGGCAGAGTTGGG AGG (reversed) Intergenic
No off target data available for this crispr