ID: 1063342642

View in Genome Browser
Species Human (GRCh38)
Location 10:5282541-5282563
Sequence CTCCCAACTCTGCCTCCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063342639_1063342642 -10 Left 1063342639 10:5282528-5282550 CCAAAGCGACCACCTCCCAACTC No data
Right 1063342642 10:5282541-5282563 CTCCCAACTCTGCCTCCGCTTGG No data
1063342636_1063342642 4 Left 1063342636 10:5282514-5282536 CCCTGAGCTCCAGACCAAAGCGA No data
Right 1063342642 10:5282541-5282563 CTCCCAACTCTGCCTCCGCTTGG No data
1063342632_1063342642 12 Left 1063342632 10:5282506-5282528 CCTCCACCCCCTGAGCTCCAGAC No data
Right 1063342642 10:5282541-5282563 CTCCCAACTCTGCCTCCGCTTGG No data
1063342638_1063342642 -5 Left 1063342638 10:5282523-5282545 CCAGACCAAAGCGACCACCTCCC No data
Right 1063342642 10:5282541-5282563 CTCCCAACTCTGCCTCCGCTTGG No data
1063342634_1063342642 6 Left 1063342634 10:5282512-5282534 CCCCCTGAGCTCCAGACCAAAGC No data
Right 1063342642 10:5282541-5282563 CTCCCAACTCTGCCTCCGCTTGG No data
1063342635_1063342642 5 Left 1063342635 10:5282513-5282535 CCCCTGAGCTCCAGACCAAAGCG No data
Right 1063342642 10:5282541-5282563 CTCCCAACTCTGCCTCCGCTTGG No data
1063342633_1063342642 9 Left 1063342633 10:5282509-5282531 CCACCCCCTGAGCTCCAGACCAA No data
Right 1063342642 10:5282541-5282563 CTCCCAACTCTGCCTCCGCTTGG No data
1063342631_1063342642 15 Left 1063342631 10:5282503-5282525 CCACCTCCACCCCCTGAGCTCCA No data
Right 1063342642 10:5282541-5282563 CTCCCAACTCTGCCTCCGCTTGG No data
1063342637_1063342642 3 Left 1063342637 10:5282515-5282537 CCTGAGCTCCAGACCAAAGCGAC No data
Right 1063342642 10:5282541-5282563 CTCCCAACTCTGCCTCCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063342642 Original CRISPR CTCCCAACTCTGCCTCCGCT TGG Intergenic
No off target data available for this crispr