ID: 1063342646

View in Genome Browser
Species Human (GRCh38)
Location 10:5282553-5282575
Sequence CCTCCGCTTGGCTGTCTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063342640_1063342646 -7 Left 1063342640 10:5282537-5282559 CCACCTCCCAACTCTGCCTCCGC No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data
1063342639_1063342646 2 Left 1063342639 10:5282528-5282550 CCAAAGCGACCACCTCCCAACTC No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data
1063342637_1063342646 15 Left 1063342637 10:5282515-5282537 CCTGAGCTCCAGACCAAAGCGAC No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data
1063342636_1063342646 16 Left 1063342636 10:5282514-5282536 CCCTGAGCTCCAGACCAAAGCGA No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data
1063342632_1063342646 24 Left 1063342632 10:5282506-5282528 CCTCCACCCCCTGAGCTCCAGAC No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data
1063342631_1063342646 27 Left 1063342631 10:5282503-5282525 CCACCTCCACCCCCTGAGCTCCA No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data
1063342634_1063342646 18 Left 1063342634 10:5282512-5282534 CCCCCTGAGCTCCAGACCAAAGC No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data
1063342638_1063342646 7 Left 1063342638 10:5282523-5282545 CCAGACCAAAGCGACCACCTCCC No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data
1063342641_1063342646 -10 Left 1063342641 10:5282540-5282562 CCTCCCAACTCTGCCTCCGCTTG No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data
1063342633_1063342646 21 Left 1063342633 10:5282509-5282531 CCACCCCCTGAGCTCCAGACCAA No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data
1063342635_1063342646 17 Left 1063342635 10:5282513-5282535 CCCCTGAGCTCCAGACCAAAGCG No data
Right 1063342646 10:5282553-5282575 CCTCCGCTTGGCTGTCTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063342646 Original CRISPR CCTCCGCTTGGCTGTCTCAT AGG Intergenic
No off target data available for this crispr