ID: 1063350813

View in Genome Browser
Species Human (GRCh38)
Location 10:5352937-5352959
Sequence CTGTGTGTGGGGAGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063350813_1063350822 6 Left 1063350813 10:5352937-5352959 CCCTCCATCCTCCCCACACACAG No data
Right 1063350822 10:5352966-5352988 CCTTTCCAGTCCTCAGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063350813 Original CRISPR CTGTGTGTGGGGAGGATGGA GGG (reversed) Intergenic
No off target data available for this crispr