ID: 1063350822

View in Genome Browser
Species Human (GRCh38)
Location 10:5352966-5352988
Sequence CCTTTCCAGTCCTCAGTTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063350818_1063350822 -6 Left 1063350818 10:5352949-5352971 CCCACACACAGAGCCATCCTTTC No data
Right 1063350822 10:5352966-5352988 CCTTTCCAGTCCTCAGTTCCCGG No data
1063350816_1063350822 -2 Left 1063350816 10:5352945-5352967 CCTCCCCACACACAGAGCCATCC No data
Right 1063350822 10:5352966-5352988 CCTTTCCAGTCCTCAGTTCCCGG No data
1063350811_1063350822 16 Left 1063350811 10:5352927-5352949 CCCTGCATGGCCCTCCATCCTCC No data
Right 1063350822 10:5352966-5352988 CCTTTCCAGTCCTCAGTTCCCGG No data
1063350812_1063350822 15 Left 1063350812 10:5352928-5352950 CCTGCATGGCCCTCCATCCTCCC No data
Right 1063350822 10:5352966-5352988 CCTTTCCAGTCCTCAGTTCCCGG No data
1063350819_1063350822 -7 Left 1063350819 10:5352950-5352972 CCACACACAGAGCCATCCTTTCC No data
Right 1063350822 10:5352966-5352988 CCTTTCCAGTCCTCAGTTCCCGG No data
1063350815_1063350822 2 Left 1063350815 10:5352941-5352963 CCATCCTCCCCACACACAGAGCC No data
Right 1063350822 10:5352966-5352988 CCTTTCCAGTCCTCAGTTCCCGG No data
1063350814_1063350822 5 Left 1063350814 10:5352938-5352960 CCTCCATCCTCCCCACACACAGA No data
Right 1063350822 10:5352966-5352988 CCTTTCCAGTCCTCAGTTCCCGG No data
1063350813_1063350822 6 Left 1063350813 10:5352937-5352959 CCCTCCATCCTCCCCACACACAG No data
Right 1063350822 10:5352966-5352988 CCTTTCCAGTCCTCAGTTCCCGG No data
1063350817_1063350822 -5 Left 1063350817 10:5352948-5352970 CCCCACACACAGAGCCATCCTTT No data
Right 1063350822 10:5352966-5352988 CCTTTCCAGTCCTCAGTTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063350822 Original CRISPR CCTTTCCAGTCCTCAGTTCC CGG Intergenic
No off target data available for this crispr