ID: 1063350959

View in Genome Browser
Species Human (GRCh38)
Location 10:5354657-5354679
Sequence AGGGAGAAGAAATATGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063350959_1063350968 23 Left 1063350959 10:5354657-5354679 CCTTCTCCATATTTCTTCTCCCT No data
Right 1063350968 10:5354703-5354725 CAGGTAAAGTTGTTCTAGTCTGG No data
1063350959_1063350965 4 Left 1063350959 10:5354657-5354679 CCTTCTCCATATTTCTTCTCCCT No data
Right 1063350965 10:5354684-5354706 CCAACAGCCTGCTTTTAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063350959 Original CRISPR AGGGAGAAGAAATATGGAGA AGG (reversed) Intergenic
No off target data available for this crispr