ID: 1063351622

View in Genome Browser
Species Human (GRCh38)
Location 10:5362088-5362110
Sequence CAGCATGAGCATGTTGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063351622_1063351626 9 Left 1063351622 10:5362088-5362110 CCCTGAACAACATGCTCATGCTG No data
Right 1063351626 10:5362120-5362142 AAGATACCAATGACTCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063351622 Original CRISPR CAGCATGAGCATGTTGTTCA GGG (reversed) Intergenic
No off target data available for this crispr