ID: 1063352720

View in Genome Browser
Species Human (GRCh38)
Location 10:5371628-5371650
Sequence TCTGCAGCTCCTCATCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 6, 3: 26, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063352720_1063352722 19 Left 1063352720 10:5371628-5371650 CCACACTGATGAGGAGCTGCAGA 0: 1
1: 0
2: 6
3: 26
4: 206
Right 1063352722 10:5371670-5371692 CACCGACTGCCAGCCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063352720 Original CRISPR TCTGCAGCTCCTCATCAGTG TGG (reversed) Intronic
901229346 1:7633361-7633383 TCTGCAGCTCTTCCTCTCTGAGG - Intronic
902955250 1:19920945-19920967 TCTGCCTGTCCTCATCAGAGTGG + Intronic
904841132 1:33372668-33372690 TCTGCAGCTCCTCCCCAGCACGG + Intronic
905308084 1:37032910-37032932 TCTACAGCTCTTCTTCAGGGCGG - Intronic
908783372 1:67712070-67712092 TCTGCAGCTCCTCAACAGCTGGG + Intronic
910288966 1:85581555-85581577 TCTGCAGATCCCCTTCAGAGCGG - Exonic
914323296 1:146586156-146586178 TCTTCAGCTCCTGACCACTGAGG + Intergenic
915180067 1:154051032-154051054 TCATCAGTTGCTCATCAGTGTGG - Intronic
915780810 1:158547922-158547944 TATGCAGCTGCCCATCACTGTGG + Exonic
916721756 1:167489716-167489738 GCCGCAGCTCCTCAGCAGCGGGG - Intronic
918174592 1:182031872-182031894 TCTGGACATTCTCATCAGTGTGG + Intergenic
920038187 1:203079110-203079132 GTTGCAGTTCCTCCTCAGTGTGG + Intergenic
923454449 1:234151106-234151128 CCAGCAGCCCCTCCTCAGTGTGG - Intronic
923879806 1:238091336-238091358 TCTGCAGCTCCTCCGTAGTGGGG + Intergenic
924774509 1:247106467-247106489 CCTGAAGCTCCTCCTCAGTGTGG - Intergenic
1063035967 10:2287002-2287024 TCTGCATGTCCTCTTTAGTGAGG + Intergenic
1063352720 10:5371628-5371650 TCTGCAGCTCCTCATCAGTGTGG - Intronic
1063580009 10:7297605-7297627 TCTGCAGTAGCTCATCAGAGTGG - Intronic
1066053695 10:31660837-31660859 TTTACAGCGCCTCAGCAGTGTGG - Intergenic
1068324452 10:55466076-55466098 TCTGGAGCTCATCATTAATGGGG + Intronic
1070678616 10:78433319-78433341 TCTCCAGCTCCAGCTCAGTGGGG + Intergenic
1071575624 10:86723886-86723908 TCTCCAGCTCCTTATCAGCATGG - Intronic
1072747305 10:97949724-97949746 TCTGCAACTCTTCAGCTGTGTGG + Intronic
1074446475 10:113525181-113525203 TCCCCAGCTCCTCATCAGTTGGG - Intergenic
1075052262 10:119191524-119191546 TCTGGGGCTCCTCTTCAATGAGG - Intergenic
1075400643 10:122159160-122159182 GGGGCAGCTCCTCAGCAGTGAGG + Intronic
1076564631 10:131389741-131389763 CCTGCAGCCCCTGATCAGTGTGG + Intergenic
1076999904 11:317573-317595 TCAGCAGCTCATCATGATTGAGG - Intergenic
1077269310 11:1667624-1667646 TCTGCAGCTTCTGAGCACTGAGG - Intergenic
1078098279 11:8313585-8313607 CCTGCAGCTGCTCTTCCGTGTGG - Intergenic
1078639122 11:13079058-13079080 TCTGCAGTTCCTCAGGACTGTGG - Intergenic
1078860298 11:15240468-15240490 TCTGCAGATCCCCATCAGAGAGG + Exonic
1079328478 11:19514370-19514392 TCTGCAGCTCTTTAACATTGCGG + Intronic
1081375025 11:42348297-42348319 TCTGCTGCCAATCATCAGTGAGG + Intergenic
1081534845 11:43989184-43989206 TCTGCCGCTCATCAGCTGTGTGG + Intergenic
1082744533 11:56947890-56947912 ACTGCAGCTCCTCACCAGCAAGG - Intergenic
1084082855 11:66840357-66840379 ACTGCAGAACCTCATCAGTGTGG + Intronic
1084548348 11:69825704-69825726 GCTGCAGCCCCTCATCTCTGGGG + Intergenic
1084641996 11:70431724-70431746 CTTGCAGCCCCTCATGAGTGTGG + Intronic
1085076671 11:73597917-73597939 CCTGCAGCTGCTCACCGGTGAGG - Exonic
1085170460 11:74445327-74445349 TCTGGGGCTCCTCATCAGCCTGG + Intergenic
1085406684 11:76267354-76267376 TCTCCAGCTCCTCTTCCTTGTGG + Intergenic
1086455620 11:86956096-86956118 TCTGCAGCTCCGCAGCTCTGGGG - Intergenic
1088384297 11:109235881-109235903 TCTGAATCTCCTCATCTGTAAGG - Intergenic
1088712951 11:112524783-112524805 TCTTCAGTTCCTCAGGAGTGTGG + Intergenic
1091180063 11:133596291-133596313 TCTGCAGCTCCTGCTCAGAGTGG - Intergenic
1093383590 12:18523744-18523766 TCTGCAGTTCCTCCCCAGTATGG + Intronic
1094754720 12:33454715-33454737 TCTGCAGTTCGTCATCAGTTAGG - Intergenic
1097693664 12:62757050-62757072 TCTGCAGAGTCTCATCATTGGGG - Intronic
1101139261 12:101778210-101778232 GCTGCAGCTGCCCACCAGTGCGG - Intronic
1101653093 12:106695281-106695303 TCTGCAGCACATCTTCAGTTGGG - Intronic
1101683913 12:106997810-106997832 TCTGCTGCCCATCATGAGTGGGG + Intronic
1104371753 12:128229593-128229615 TCTGCTGCTTATCATCTGTGTGG - Intergenic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1105962679 13:25356223-25356245 TCTTCAGCTCCTCAGCACTGAGG + Intergenic
1106451748 13:29888672-29888694 TCTGCAGCTGCCCAGCAGGGAGG - Intergenic
1108081386 13:46740511-46740533 TGTGCAGCTGCTTAGCAGTGAGG + Intronic
1108341230 13:49500026-49500048 TCTGCAGGCCCTCTTCAATGTGG - Intronic
1109473928 13:62852697-62852719 TCTTCCGATCATCATCAGTGGGG - Intergenic
1109568187 13:64147699-64147721 TCTGCAGCTACTTATTATTGAGG + Intergenic
1110777844 13:79431786-79431808 TGTGGAACTCCTTATCAGTGTGG - Intergenic
1111790163 13:92845318-92845340 TCTGCAGCTGACCATGAGTGAGG - Intronic
1113584818 13:111458010-111458032 TCTGCTGCTCCCCAGCTGTGTGG + Intergenic
1115116907 14:29891532-29891554 TCAGCACCTCCTCTTCTGTGAGG + Intronic
1115883433 14:37945711-37945733 ACTGGAGCTCCTCACCAGTCAGG - Intronic
1118365797 14:65094754-65094776 TCAGCAGGTCCCCATCAGAGGGG + Intronic
1118590418 14:67396760-67396782 TCTGCAGCTCCTGATAGCTGTGG + Intronic
1118596835 14:67442226-67442248 TCTGCAGCACCCCATCCTTGAGG + Intergenic
1119206060 14:72794368-72794390 TCTGCTTCTGCTCATCTGTGTGG - Intronic
1120495747 14:85232917-85232939 TCTCCAAGACCTCATCAGTGCGG - Intergenic
1121559922 14:94866882-94866904 CCTGCTCCTCCTCATCAGTAGGG - Intergenic
1122660447 14:103291286-103291308 TCTGAAGCTCTCAATCAGTGGGG + Intergenic
1123541089 15:21292393-21292415 GCTCCAGGTCATCATCAGTGTGG - Intergenic
1124344379 15:28912379-28912401 TCTAAAACTCCTCCTCAGTGAGG - Intronic
1124986197 15:34618270-34618292 TCTGCAGATCCTCTTTAGTGAGG - Intergenic
1128000323 15:64185398-64185420 TCTGCTGCTCCTCATTACTTTGG - Intronic
1129599271 15:76988794-76988816 TCTGCACTTCCTCCTCAGTGGGG + Intergenic
1129608958 15:77038202-77038224 CCTGCAGCAGCTCATCAGTGTGG - Intergenic
1129726291 15:77903383-77903405 TCTGCAGCACAGAATCAGTGTGG - Intergenic
1131075869 15:89494574-89494596 GCTGCAGAACCTCACCAGTGGGG - Intronic
1131384347 15:91990898-91990920 TCTACTGCTCCTCAACACTGAGG - Intronic
1202949402 15_KI270727v1_random:19534-19556 GCTCCAGGTCATCATCAGTGTGG - Intergenic
1134355872 16:13481754-13481776 TTTGCAGATCCTCATCACTGTGG - Intergenic
1136927484 16:34388515-34388537 CCTGCAGTTCCTCAGCAGAGAGG - Intergenic
1136977090 16:35023291-35023313 CCTGCAGTTCCTCAGCAGAGAGG + Exonic
1138182365 16:54950161-54950183 TCTGCAGCTCATCCTCGGTGGGG - Intergenic
1140145247 16:72300486-72300508 TCTGCTGCTTGTCAGCAGTGGGG + Intergenic
1141626086 16:85261828-85261850 TCTGCAGCTGGGCAGCAGTGGGG + Intergenic
1143367848 17:6420135-6420157 TCTCCAGCTCCTCAGGGGTGTGG - Intronic
1147952473 17:44114758-44114780 TCTGCATGTTCTCCTCAGTGGGG - Intronic
1148796575 17:50200090-50200112 TCGCCTGCTCCTCATCAGCGCGG + Intronic
1148968163 17:51455384-51455406 TCTGCTCTTCCTCATCTGTGTGG - Intergenic
1149646561 17:58245570-58245592 TCTGCACCGCCTCAACAGTAGGG - Intronic
1150331251 17:64296107-64296129 TCTATAGTTCCTCAGCAGTGGGG - Intergenic
1151397604 17:73834373-73834395 TCTGAAGCTCAACAGCAGTGAGG + Intergenic
1151927461 17:77209383-77209405 TCTCCAGCTCCTCTGCAGTCCGG - Exonic
1152720785 17:81923003-81923025 TCACCAGCTCCTCATCCGTCAGG + Exonic
1153015728 18:580816-580838 CCTGCAGCTCCTCATCCGTGAGG - Exonic
1153171931 18:2326735-2326757 TCTCCAGCTCCTCATCCAGGGGG + Intergenic
1153675740 18:7454594-7454616 TCTGCAGCACCTCCTCAATGTGG + Intergenic
1154080847 18:11255014-11255036 TATGCATCTCCTCATAAGTAAGG + Intergenic
1155159348 18:23183088-23183110 CCTGCGTCCCCTCATCAGTGTGG + Intronic
1155512604 18:26593243-26593265 TCTGAAGCTTCTCATAAGGGAGG + Intronic
1162457637 19:10795655-10795677 TCTGCAGCTCCTGATCAAATAGG + Intronic
1165429532 19:35764710-35764732 TCTGCTCCTCCTCCTCAGGGAGG - Intronic
1166258975 19:41625110-41625132 CCTGAAGCTTCTCATCAGTGAGG - Intronic
1166976546 19:46608291-46608313 CCTGCAGCTCTGCTTCAGTGGGG - Exonic
925464455 2:4094509-4094531 TGTGTAGCTACTCATAAGTGTGG - Intergenic
926800589 2:16656608-16656630 TCAGCAGCTCCTCCTCTCTGAGG - Intronic
927640263 2:24841411-24841433 GCTCCAGCCCCTCCTCAGTGAGG + Intronic
927883750 2:26706294-26706316 TCTCCAGCTCCTCCTCTGGGGGG - Intronic
930857058 2:56030149-56030171 TCTGCAGCTCAGCATCTGTCAGG + Intergenic
932784058 2:74584253-74584275 TCAGCAGCTTCTCTTCAGTGAGG + Intronic
933844869 2:86317060-86317082 GGTGCACCTCCTCATCAATGTGG + Intronic
938473907 2:131590425-131590447 TCTGCATCTCCCCATCAGAGTGG + Intergenic
940674290 2:156709686-156709708 TCTGGAGCTCCTCATGGTTGTGG + Intergenic
942246418 2:174012920-174012942 TCTGCCGCTCCTCCGCCGTGGGG + Intergenic
942566037 2:177265120-177265142 TCTGCAACTCCAAATCAGGGAGG - Exonic
943516083 2:188888891-188888913 TATGTAGCTCATTATCAGTGAGG - Intergenic
946228833 2:218279314-218279336 CGTGCAGCTGCTCATCACTGTGG - Exonic
948188853 2:236043163-236043185 TTTACAGTTCATCATCAGTGTGG - Intronic
948871061 2:240798446-240798468 TCTCCTGCTTCTCCTCAGTGGGG - Intronic
1172656594 20:36541844-36541866 TCTCCAGCTCCTCAGCAAAGGGG - Intronic
1173944722 20:46941379-46941401 TCTTCTGCTCCTCAGCTGTGTGG + Intronic
1175223806 20:57433297-57433319 TCTGCAGCTCCACAGCCATGTGG + Intergenic
1175519594 20:59591544-59591566 ACTCCAGCTCCTCATCATGGGGG + Intronic
1175618103 20:60420637-60420659 TCTGCAGCTCTACAACAGTCAGG - Intergenic
1175627995 20:60505086-60505108 TATTCAGCTCCTACTCAGTGAGG + Intergenic
1175878985 20:62245724-62245746 TCTGCAGCCCGTCACGAGTGAGG - Intronic
1176601573 21:8799244-8799266 TGGGCATGTCCTCATCAGTGAGG - Intergenic
1179096409 21:38319897-38319919 TCTGAAGCTTCTCTTAAGTGTGG - Intergenic
1179116957 21:38502107-38502129 TCTGAACCTCCACATCTGTGGGG + Intronic
1179549416 21:42134491-42134513 ACTGTAGCTGCTCAGCAGTGAGG + Intronic
1180343858 22:11690795-11690817 TGGGCATGTCCTCATCAGTGAGG - Intergenic
1182218787 22:28741881-28741903 TCTGCTGCTCCTCATTGGTCCGG - Intronic
1182718161 22:32376588-32376610 TCTGTAACTCCTCCTCTGTGAGG + Intronic
1184436429 22:44480832-44480854 CCAGCAGCTCCTAATAAGTGAGG - Intergenic
1184874484 22:47264830-47264852 TCTGCAGCTCCTCACTAGTGTGG - Intergenic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
950136026 3:10581486-10581508 TCTGCAGTTCCTCATCACTGTGG - Intronic
951914344 3:27783941-27783963 GCTTCATTTCCTCATCAGTGAGG + Intergenic
951935520 3:28018328-28018350 TCTCCCTCTCCTCATCAGAGTGG + Intergenic
954701275 3:52452133-52452155 CCTGCAGCTCCTCAGGGGTGGGG + Exonic
954897257 3:53986479-53986501 TTGCCTGCTCCTCATCAGTGGGG - Intergenic
956142064 3:66156069-66156091 TCTGGAGCCCCTGAACAGTGAGG - Intronic
956235286 3:67063129-67063151 TTTAGAGCTCCTCATCAGAGAGG - Intergenic
956335168 3:68155237-68155259 TCTGCAGTGCCTGATCAGTGGGG + Intronic
956467990 3:69537361-69537383 TCTGCAGCTCTTCAGCCTTGAGG - Intronic
956767466 3:72495990-72496012 ACTGCAGCTCCAAGTCAGTGTGG + Intergenic
957173868 3:76778418-76778440 TCTTCAGCTCCTGTTCAATGTGG + Intronic
958742794 3:98095447-98095469 ACCGCAGCTCCTCACCAGTAAGG - Intergenic
959016168 3:101136273-101136295 TCTGAAGCTCCTGATCAATTTGG - Intergenic
960821595 3:121738733-121738755 TCAGCAGATTCTCCTCAGTGTGG - Intronic
961127739 3:124435722-124435744 TCTGCAGCTCCTCACTTCTGTGG - Intronic
962084199 3:132173525-132173547 TCTGCTGCTCCTCACCAGGCAGG + Intronic
962785882 3:138768123-138768145 TCTGCAGCTCTTCAGCAGACAGG + Intronic
963106391 3:141651014-141651036 TTTGCAGCTTCTCATCTATGTGG + Intergenic
970100425 4:12515085-12515107 TCAGCAGCTCCCCCTCACTGTGG - Intergenic
971767742 4:30854937-30854959 TATACAGCTCCTGATCAGTAAGG - Intronic
972155786 4:36159896-36159918 TCTGCAGCTCCTGATTAGATTGG - Intronic
974654049 4:64796680-64796702 TCTGCAGATTCTAATCAGTTTGG - Intergenic
975377414 4:73661789-73661811 TCTGCAGCTCTTGGTAAGTGAGG + Intergenic
978768795 4:112432315-112432337 ACTCCAGCTCATCCTCAGTGTGG + Exonic
979338209 4:119488399-119488421 TCTCCTGCTTCTCATCAATGTGG - Intergenic
980445678 4:132904294-132904316 TTTGCATCTCCTCATCAGTAAGG + Intergenic
985171831 4:187158226-187158248 TCTGCAGCTCCTCAACGGTGTGG + Intergenic
990333931 5:54754033-54754055 AATGCAGCTTCTCTTCAGTGGGG + Intergenic
996762092 5:126996591-126996613 GTTGCAGCTCTTCTTCAGTGGGG + Intronic
997065591 5:130555545-130555567 TCAGCAGGTCCTGACCAGTGAGG - Intergenic
997377610 5:133408543-133408565 GATGCAGCTCCTCTTCACTGAGG + Intronic
998467732 5:142358919-142358941 TCTGCAGTTCCTCAACTCTGAGG + Intergenic
998647272 5:144076243-144076265 TGGGCAGGTGCTCATCAGTGGGG - Intergenic
998793169 5:145788020-145788042 TCTGCAGGTGCTCACCAGTTTGG - Intronic
999745615 5:154589723-154589745 TCTGCTGCTCCTCATCAGCGAGG + Intergenic
1000509708 5:162165616-162165638 TCTTCAGCCCCTGATCAGTCTGG - Intergenic
1002337236 5:178488310-178488332 TCAGCAGCTCCCCATCAGGCAGG - Intronic
1002965675 6:1963952-1963974 TCTGCTGCTCCTAGGCAGTGTGG - Intronic
1003559679 6:7170389-7170411 TCTGCTGCTCCTGGGCAGTGAGG - Intronic
1003763966 6:9214562-9214584 ACTGCAGCTCCTCACCAGCAAGG + Intergenic
1004193745 6:13486710-13486732 GCAGCAGCACCTCATCAATGCGG + Exonic
1005225467 6:23637215-23637237 TCTGCAGCACCTCAGAAGTGGGG + Intergenic
1006917632 6:37605159-37605181 CCTGCAGCCCCTCATCATGGTGG + Intergenic
1015697284 6:135995069-135995091 TCTGCATCCTCTTATCAGTGAGG + Intronic
1019188128 6:170232999-170233021 TCTGCAGCTGCACATCAGCCAGG + Intergenic
1019466716 7:1193706-1193728 TCTGCCGCTCCCCAGCTGTGTGG + Intergenic
1021154271 7:17190699-17190721 ACTGCAACTCCTCTTCAGAGAGG + Intergenic
1021263976 7:18496109-18496131 TCTGCTGCTTCTCCTCAGGGAGG + Intronic
1023679988 7:42675708-42675730 TCTGCAGCTACTCAGGAGGGAGG - Intergenic
1023855783 7:44182910-44182932 TCTGCAGCTGCTGCTCACTGCGG - Intronic
1024023904 7:45395218-45395240 TCTGCTGCTTCACACCAGTGAGG - Intergenic
1024211941 7:47213576-47213598 TCAGCAACTCCTGACCAGTGTGG - Intergenic
1026193128 7:68147764-68147786 TCTGCAGTGCTTCATGAGTGCGG - Intergenic
1028941474 7:96526688-96526710 TGTGCAGCTTCTCATCACTGTGG - Intronic
1033141132 7:138827524-138827546 TCTTGAACTCCTCATCCGTGAGG - Intronic
1034568465 7:151934734-151934756 TCTGCAGTTCATTATCTGTGTGG - Intergenic
1037950928 8:23018475-23018497 TCTTCACCTCCTCATCATGGGGG - Intronic
1037987979 8:23301523-23301545 TCTGCAGATCCTCCTCTATGAGG + Intronic
1038170689 8:25128778-25128800 GCTGGAGCTCCCCATCAGTCAGG - Intergenic
1038228613 8:25680068-25680090 TCTTCTGCTCCTCTTCAATGTGG + Intergenic
1038336531 8:26650195-26650217 CCTCCACCTCCTCATCTGTGAGG - Intronic
1038679433 8:29653164-29653186 CTTGGAGCTCCTCATCAGTAAGG - Intergenic
1039091170 8:33831226-33831248 TCTGCAGCTCCCCAGGAATGTGG + Intergenic
1040003878 8:42601561-42601583 GCTGCAGCTCCTGTCCAGTGAGG - Intergenic
1040122833 8:43701534-43701556 TCTCCTCCTCCTCCTCAGTGTGG + Intergenic
1041972567 8:63760627-63760649 CCTTCAGCTCCTGATCAGTTTGG + Intergenic
1043708008 8:83377952-83377974 TCTGCATCTCCTCTCCACTGAGG - Intergenic
1045402733 8:101834947-101834969 TCTGCAGCTCCCTATCTGTGTGG + Intronic
1045544814 8:103119035-103119057 TCTGCAGCCCTTAATCCGTGAGG + Intergenic
1047311997 8:123699747-123699769 TGGGCAGCTCCCCAGCAGTGTGG + Intronic
1050731997 9:8719506-8719528 CCTGCAACTCCTCATCAGACAGG - Intronic
1052226596 9:26096453-26096475 TCAGCAACTACTCCTCAGTGTGG + Intergenic
1053055203 9:34989815-34989837 CCCGCAGCTCCTCACCGGTGAGG + Exonic
1053488361 9:38479516-38479538 TCTGTAGTTCCTGATCAGTAGGG + Intergenic
1057210987 9:93201055-93201077 TGTGCAGCCCCTCCCCAGTGAGG + Intronic
1057390776 9:94639921-94639943 TCTGCAGCTCCTGCCCCGTGTGG + Intronic
1057668711 9:97068794-97068816 TCTGTAGTTCCTGATCAGTAGGG + Intergenic
1059372308 9:113852246-113852268 TCAGCAGCTCCATATCACTGGGG - Intergenic
1059981380 9:119775897-119775919 TCTCCTGCTCCTCTTCAGTCAGG + Intergenic
1061318735 9:129814537-129814559 TGTGGAGCTCCAGATCAGTGGGG + Intronic
1061627489 9:131849632-131849654 GCTGCAGCTCCTCATCCGAGAGG + Intergenic
1061774465 9:132951696-132951718 TGTCCAGCTCCTCCTCTGTGTGG + Intronic
1062324219 9:136004665-136004687 CCTTCATCTCCTCATCAGAGTGG + Intergenic
1188237845 X:27751420-27751442 TCTCCAGCTCCCCAGCACTGAGG - Intergenic
1189295090 X:39912240-39912262 TCTGTAGCTCCTCAACAGGATGG - Intergenic
1189307433 X:39997448-39997470 CCTCCAGCTCCTCTTCATTGCGG + Intergenic
1191984332 X:66962182-66962204 TCTGCTGCTCCTGGGCAGTGGGG + Intergenic
1192796502 X:74428047-74428069 TTTGCAACTCCCCAGCAGTGGGG + Intronic
1193803068 X:85960760-85960782 TCTTTAGCCCCTCATCACTGTGG - Intronic
1194201484 X:90957981-90958003 TCTGGAGGTCCTGGTCAGTGAGG - Intergenic
1194614852 X:96087791-96087813 TCTGTAGCTCTTCAACAGTCGGG + Intergenic
1195828033 X:109024361-109024383 ATTGCAGCTCCTCACCAGTAAGG - Intergenic
1196528782 X:116759198-116759220 GCTGCAGCTCCTGATCATTTTGG - Intergenic
1199687808 X:150280128-150280150 GCTGCAGCTCCTCAGAAATGAGG - Intergenic
1199966953 X:152828536-152828558 CCTGCAGCTCCTCATCAGTCAGG + Exonic
1200046923 X:153408170-153408192 TCTGCTGATCCTCTTCAGTGTGG - Intergenic
1200708536 Y:6463560-6463582 TCTGCATGGCCTCCTCAGTGTGG - Intergenic
1200961005 Y:8996130-8996152 TCTCCTCCTCCTCCTCAGTGTGG - Intergenic
1201025576 Y:9701148-9701170 TCTGCATGGCCTCCTCAGTGTGG + Intergenic
1202113836 Y:21451319-21451341 TCTCCTCCTCCTCCTCAGTGTGG + Intergenic