ID: 1063352806

View in Genome Browser
Species Human (GRCh38)
Location 10:5372275-5372297
Sequence GCCCATGGCCACTGTCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063352806_1063352812 27 Left 1063352806 10:5372275-5372297 CCTCAGGGACAGTGGCCATGGGC 0: 1
1: 0
2: 1
3: 26
4: 268
Right 1063352812 10:5372325-5372347 AGCTGATGCTGCTACTGTGAAGG No data
1063352806_1063352808 -6 Left 1063352806 10:5372275-5372297 CCTCAGGGACAGTGGCCATGGGC 0: 1
1: 0
2: 1
3: 26
4: 268
Right 1063352808 10:5372292-5372314 ATGGGCAACCTGAACTCTGACGG No data
1063352806_1063352809 1 Left 1063352806 10:5372275-5372297 CCTCAGGGACAGTGGCCATGGGC 0: 1
1: 0
2: 1
3: 26
4: 268
Right 1063352809 10:5372299-5372321 ACCTGAACTCTGACGGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063352806 Original CRISPR GCCCATGGCCACTGTCCCTG AGG (reversed) Intronic
900043001 1:487951-487973 GGGCACGGCCACTGCCCCTGGGG + Intergenic
900218701 1:1495741-1495763 GCCCAGGGCCTCTGTCCCCCAGG + Exonic
900226058 1:1534182-1534204 GCCCAGGGCCTCTGTCCCCCAGG + Exonic
900564315 1:3324880-3324902 GCCCTGGGCCAGAGTCCCTGAGG + Intronic
901626796 1:10629401-10629423 TCCCTTGCCCAGTGTCCCTGGGG + Intronic
901735095 1:11307096-11307118 GCCCATGGCCCAAGTCCCAGAGG - Intergenic
903229477 1:21913207-21913229 GCCCATTGCCACCCTCCCAGAGG - Intronic
903747918 1:25601127-25601149 GGCCATGTCCTCTGCCCCTGGGG - Intergenic
903815429 1:26061008-26061030 GGCCAGGGCTGCTGTCCCTGTGG + Intronic
905403921 1:37720767-37720789 CCCCAGGGCCACTCACCCTGAGG + Exonic
905498232 1:38413527-38413549 GCCCATGGCACCTGTGACTGTGG - Intergenic
905646323 1:39626983-39627005 GCCCACGCCCACTGGCCCTTTGG - Exonic
905798357 1:40828133-40828155 TCCCAGGGCCACTCTCACTGGGG - Intronic
906286712 1:44592465-44592487 GCCACTGACCACTGTGCCTGGGG + Intronic
906685808 1:47762479-47762501 GCCCAGGGCCATTGTCACAGTGG - Exonic
911753707 1:101528513-101528535 GCCAATTGCTACTTTCCCTGTGG - Intergenic
916231072 1:162541864-162541886 CCCTATGGCCACTGTTCCTTGGG + Intergenic
916284653 1:163093400-163093422 GTCCATGGGCACAGGCCCTGGGG - Intergenic
917469185 1:175311682-175311704 GCCCCTGGCCCCTGCCCCCGGGG + Intergenic
917471519 1:175330029-175330051 TCCCATGCCCACTGTCCTTGGGG + Intronic
918114931 1:181487712-181487734 GCCCAGGGCCAGTTACCCTGTGG + Intronic
918894387 1:190320841-190320863 GGCCAGGGCCACTGTCTGTGTGG - Intronic
919751205 1:201039424-201039446 GCCCATGGGCAGGGTTCCTGGGG + Intergenic
921335258 1:214079316-214079338 GGCCATCGCCACTGTCTGTGTGG + Intergenic
1063352806 10:5372275-5372297 GCCCATGGCCACTGTCCCTGAGG - Intronic
1065129033 10:22601930-22601952 GCCACTGGCCACTGAACCTGTGG + Intronic
1066703367 10:38153053-38153075 GGCCATGGCCACTTTCCCCGTGG - Intergenic
1066987419 10:42480169-42480191 GGCCATGGCCACTTTCCCCGTGG + Intergenic
1067296842 10:44979553-44979575 ACCCCTGACCACTGTACCTGTGG - Intronic
1069757911 10:70785136-70785158 GCCCCTGCTCTCTGTCCCTGGGG + Intronic
1071393104 10:85195272-85195294 GGCCATGGCCCCTGTCACTGTGG + Intergenic
1073804561 10:107083224-107083246 GCTCATTGCCTCTGTCTCTGAGG + Intronic
1074415350 10:113262659-113262681 GCCCTTGGCCACTCTGCCAGTGG + Intergenic
1075712538 10:124538261-124538283 ACCCACGGTCACTCTCCCTGGGG + Intronic
1076701519 10:132275613-132275635 GCCCCTGGCCACTGGCCCCGTGG - Intronic
1076809691 10:132880032-132880054 GCTCAGGGCCACCCTCCCTGTGG - Intronic
1076821167 10:132940449-132940471 GGCCAAGGCCGCTGTCCCTGCGG - Intronic
1077124133 11:925081-925103 GCCCCCGGCCGCTGTCACTGGGG + Intronic
1078080968 11:8204573-8204595 CCCCATGGCCCCTGTGGCTGAGG + Intergenic
1079171778 11:18103472-18103494 GGCCAGGGCCACTGTCTGTGTGG + Intronic
1080521641 11:33072526-33072548 GCCATTGCCCACAGTCCCTGGGG + Exonic
1081570955 11:44290482-44290504 AACCATGGCCCCTGTCACTGAGG - Intronic
1081852669 11:46284678-46284700 GAACATGGCCCCAGTCCCTGTGG - Intronic
1082000147 11:47389717-47389739 GCCCCTGGCCACTGGGGCTGGGG - Intergenic
1082013454 11:47466971-47466993 GCCCAAGGCCGCTCTGCCTGGGG - Intronic
1082642753 11:55685284-55685306 GGCCAGGGCCACTGTCTGTGTGG - Intergenic
1083827107 11:65210158-65210180 GCCCCAGGCCCTTGTCCCTGGGG + Intronic
1083855151 11:65389621-65389643 GCCGCTGGCCACTGCCCATGGGG + Intronic
1083986763 11:66220723-66220745 TCTCAGGGCCACTGTCGCTGGGG - Exonic
1084178452 11:67435193-67435215 GCCCTTGAGCCCTGTCCCTGCGG + Exonic
1084365187 11:68693072-68693094 GTCCATGGCCACTGGATCTGGGG - Intergenic
1084619975 11:70263070-70263092 CCCCATGGCCTCTGTCCTTGAGG - Intergenic
1084942201 11:72618764-72618786 GCCCATGGCCAGCGTCCCATGGG - Intronic
1086279778 11:85171979-85172001 GGAAGTGGCCACTGTCCCTGTGG + Intronic
1087757853 11:102073720-102073742 TGCCATGGCCACTGTTGCTGGGG - Intronic
1089650737 11:119911103-119911125 TTCCATGGCCAGTGTCCTTGGGG - Intergenic
1089937396 11:122378107-122378129 GCCTCTGGCCACTGTCCCGAAGG - Intergenic
1090536388 11:127646156-127646178 TGCCAGGACCACTGTCCCTGTGG - Intergenic
1090828873 11:130406993-130407015 TCCCTTGGCCACTTTCCCTCAGG - Intronic
1090965982 11:131597986-131598008 GCCTGTGGCTCCTGTCCCTGGGG - Intronic
1092138602 12:6167215-6167237 TCCCATGGCCACTATTCCTACGG - Intergenic
1095369772 12:41453187-41453209 GCCCATGCCCCCCGCCCCTGGGG + Intronic
1096747542 12:53738607-53738629 ACCCCAGGCCACTGTCCCTCGGG - Intergenic
1096777264 12:53971955-53971977 GCCCCCAGCCTCTGTCCCTGGGG - Intergenic
1097179132 12:57160923-57160945 GCCCACGCCGACTGTCCTTGGGG - Exonic
1100122833 12:91388658-91388680 TCCCATGGTCACTGCTCCTGAGG - Intergenic
1100452073 12:94716661-94716683 GGCCAGGGCCACTGTCTGTGTGG - Intergenic
1101590653 12:106122293-106122315 GCTCATGGCCACTGGACTTGGGG - Intronic
1102678463 12:114674236-114674258 GGCCATGGCCTCTGCCGCTGCGG - Exonic
1103175869 12:118862606-118862628 GCCCTTGGCCACTCTCCCAGAGG - Intergenic
1103823996 12:123721467-123721489 GCCCATGGCAGCTGTCACTGTGG + Intronic
1104103229 12:125634950-125634972 GCCCAGGGCCAGTGGACCTGGGG - Intronic
1104918384 12:132278095-132278117 GCCCCTGCCTACTGTCCCCGGGG - Intronic
1105599674 13:21875612-21875634 GCCCTTGCCCACTGTCCTTACGG - Intergenic
1105706586 13:22971193-22971215 TCCCATGGCCATTTTCCCTGTGG + Intergenic
1107443834 13:40452395-40452417 GTCCCTTGCAACTGTCCCTGGGG - Intergenic
1107569764 13:41644452-41644474 GGCCAGGGCCACTGTCTGTGTGG + Intronic
1109152502 13:58861270-58861292 GTCCATGGCCACAGGCCCAGGGG + Intergenic
1112784136 13:102933384-102933406 GTCCTTGGCCACAGTCTCTGCGG + Intergenic
1113765992 13:112881508-112881530 GTCCATGGCCTGTATCCCTGGGG + Intronic
1114629779 14:24151616-24151638 GCTCAGGGCCACTGTCCCAGAGG - Exonic
1115962390 14:38850134-38850156 GGCCATGTTCTCTGTCCCTGAGG - Intergenic
1117338937 14:54777590-54777612 GACTCTGGCCACTCTCCCTGGGG + Intronic
1117548687 14:56812611-56812633 CCCCATGCCCACTGTCCCCAAGG - Intergenic
1118082885 14:62382113-62382135 GGCCAGGGCCACTGTCTATGTGG + Intergenic
1118244526 14:64096417-64096439 ACCCCTGGCCACAGTCCATGAGG - Intronic
1121017979 14:90559979-90560001 CCCCTTGGCCCCTGTCCCTCTGG + Intronic
1121158654 14:91712923-91712945 GGCCAGGGCCACTGTCTGTGTGG - Intronic
1121504287 14:94464539-94464561 GCCTATGGCCACCATCCCTCTGG - Intronic
1122811257 14:104290464-104290486 GCAAGTGGCCACCGTCCCTGGGG - Intergenic
1123473496 15:20571332-20571354 GCCCATGCCGAGTGTCCCAGAGG + Intergenic
1123644513 15:22429021-22429043 GCCCATGCCGAGTGTCCCAGAGG - Intergenic
1123665829 15:22608929-22608951 GCCCATGCCGAGTGTCCCAGAGG - Intergenic
1123733794 15:23166343-23166365 GCCCATGCCGAGTGTCCCAGAGG + Intergenic
1123963858 15:25436866-25436888 GGACATTGCCCCTGTCCCTGAGG - Intronic
1124199695 15:27668433-27668455 GCTTGTGGCCACTGTGCCTGTGG - Intergenic
1124319652 15:28703342-28703364 GCCCATGCCGAGTGTCCCAGAGG - Exonic
1124482859 15:30092088-30092110 GCCCATGCCGAGTGTCCCAGAGG + Exonic
1124489313 15:30144159-30144181 GCCCATGCCGAGTGTCCCAGAGG + Exonic
1124520717 15:30405130-30405152 GCCCATGCCGAGTGTCCCAGAGG - Exonic
1124537942 15:30561089-30561111 GCCCATGCCGAGTGTCCCAGAGG + Exonic
1124544402 15:30613150-30613172 GCCCATGCCGAGTGTCCCAGAGG + Exonic
1124564364 15:30800586-30800608 GCCCATGCCGAGTGTCCCAGAGG + Intergenic
1124754216 15:32394168-32394190 GCCCATGCCGAGTGTCCCAGAGG - Exonic
1124760710 15:32446497-32446519 GCCCATGCCGAGTGTCCCAGAGG - Exonic
1124777923 15:32602566-32602588 GCCCATGCCGAGTGTCCCAGAGG + Exonic
1126411294 15:48375535-48375557 GCTCATGGCCTCTGGCTCTGTGG + Intergenic
1128133983 15:65249343-65249365 CCACTGGGCCACTGTCCCTGGGG - Intronic
1129867263 15:78918620-78918642 GCCCAAGCCCACAATCCCTGCGG + Intergenic
1130969539 15:88721249-88721271 GCCCATGGCAGATGTCCCAGTGG + Intergenic
1131354480 15:91732757-91732779 GCCCCTGGCCAGTGACCCTTTGG + Intergenic
1131841436 15:96441756-96441778 GCCCATGGCAACAGCCTCTGAGG - Intergenic
1134137506 16:11687861-11687883 GCCCATGGACACATTCACTGTGG - Exonic
1135673534 16:24394804-24394826 TGTCATGGCCACTGTCCCAGGGG - Intergenic
1137502624 16:49023188-49023210 TCCCATGGCTACAGTCCATGTGG - Intergenic
1137604525 16:49778657-49778679 GGGCATGGCCACAGTGCCTGGGG - Intronic
1137675252 16:50300893-50300915 GCCCCAGGCCTCTGTCCCTGCGG - Intronic
1138885447 16:61072409-61072431 TCCCCTGGCCAATGTCTCTGGGG + Intergenic
1139372924 16:66479763-66479785 TCCCACTGCCACTGTCTCTGGGG - Intronic
1139464102 16:67144981-67145003 GCCCATGGCCTCAGTTCCTCTGG + Intronic
1139489362 16:67278427-67278449 GCCCAGGCCCATGGTCCCTGGGG - Exonic
1139853378 16:69963467-69963489 GCCCATGGCCGTGGTCCCTGTGG - Intronic
1139882347 16:70186376-70186398 GCCCATGGCCGTGGTCCCTGTGG - Intronic
1140205222 16:72927966-72927988 ACCCACGGCCACTGTGCCTTTGG + Intronic
1140370162 16:74409128-74409150 GCCCATGGCCGTGGTCCCTGTGG + Intronic
1141702091 16:85647176-85647198 GTCCATGCCCCCTGTCCTTGGGG + Intronic
1142287097 16:89175909-89175931 AACCATGGCCACCTTCCCTGGGG - Intronic
1142314680 16:89336181-89336203 GCTCAGAGCCACTGTCCTTGTGG + Intronic
1143217445 17:5235434-5235456 GCCCACGGCCTCTGACCATGGGG + Intergenic
1144106669 17:11992441-11992463 ACCCATTGCCACAGTCTCTGGGG + Exonic
1144340040 17:14302994-14303016 CCCCGGGGCCACTGTCCCTTTGG - Intronic
1144948164 17:18980382-18980404 TCCCTTGGCCACAGTCTCTGAGG - Intronic
1146289606 17:31598163-31598185 GCCCATCCTCACTGACCCTGAGG + Intergenic
1148201350 17:45752063-45752085 TGCCATGGCCACAGCCCCTGGGG + Intergenic
1149459975 17:56820570-56820592 GCCCCGGGCCACTGTCTGTGTGG - Intronic
1149993164 17:61393956-61393978 GCCCATGGCCTGTCTTCCTGGGG + Intergenic
1150625479 17:66838457-66838479 GCCCATGGCCAGGCTCCTTGTGG + Intronic
1151702463 17:75750653-75750675 GACCAGGACCCCTGTCCCTGGGG + Intronic
1151786495 17:76277493-76277515 GCCCATGTGCACAGTCACTGGGG - Intronic
1152094167 17:78263523-78263545 CCAGATGGCCACTGTGCCTGAGG - Intergenic
1152801246 17:82331731-82331753 CCACCTGGCCACTTTCCCTGGGG - Intronic
1152874593 17:82779495-82779517 CCCCTCCGCCACTGTCCCTGTGG - Intronic
1155474814 18:26226989-26227011 GGCCATGGTCACGGTCCCCGAGG - Exonic
1156405450 18:36778666-36778688 GCCAATGACCACTCTCACTGGGG - Intronic
1156461975 18:37326326-37326348 GGCCATGGCCAGGGTCCCAGGGG - Intronic
1157449754 18:47776539-47776561 ACCAATGGCCACTGTTCATGGGG - Intergenic
1159156626 18:64591587-64591609 GCCCATGGCCAATGTCATTCAGG - Intergenic
1160054240 18:75464454-75464476 GCCCAAGGCCAGTGTGCATGCGG - Intergenic
1160235118 18:77079334-77079356 ACCCATGGCCACGGCCACTGTGG + Intronic
1161124933 19:2550572-2550594 GGCCATGGTCACTCTCCCTGGGG - Intronic
1161342337 19:3750153-3750175 TCCTGTCGCCACTGTCCCTGGGG - Exonic
1162500843 19:11052745-11052767 GCCCATGGCCACTGTCTGCAGGG - Intronic
1165080607 19:33303846-33303868 GCCCCTCGCCACTGGCGCTGAGG + Intergenic
1166500028 19:43333336-43333358 GACCCTGGTCAGTGTCCCTGGGG - Intergenic
1167384179 19:49154577-49154599 TCCCATGGCCTCGGTGCCTGTGG + Exonic
1168145385 19:54417079-54417101 CCCCCGGGCCAGTGTCCCTGAGG - Intronic
926345142 2:11938023-11938045 TCCCATGGCCTCTGTCCCACTGG - Intergenic
926855438 2:17251345-17251367 CCACATGGCCGCTGTCCCTTTGG - Intergenic
932582548 2:73001183-73001205 TCCCAAGGCCAGTGACCCTGAGG - Intronic
933938327 2:87225121-87225143 GGCCAAGGACACTGGCCCTGGGG - Intergenic
934041892 2:88134070-88134092 TCCCATGTCCCTTGTCCCTGAGG + Intergenic
936098633 2:109554632-109554654 GGCGATGGCCACTGTCTGTGTGG - Intronic
936354808 2:111740654-111740676 GGCCAAGGACACTGGCCCTGGGG + Intergenic
938118056 2:128615504-128615526 GCCCAGTGCCCCTGTTCCTGTGG + Intergenic
946018720 2:216624753-216624775 GCCCAAGGCCACACACCCTGAGG + Intergenic
946055337 2:216896067-216896089 GCCCATGGGAATAGTCCCTGAGG - Intergenic
946416673 2:219543482-219543504 GCCCACGGCCACGGGCCCTGCGG + Exonic
948807550 2:240459553-240459575 GCCCCAGGCCACTGCCCCTGGGG + Intronic
948809206 2:240466302-240466324 GTCCTTGGCCTCTGTCCCTGGGG - Exonic
1168970968 20:1930331-1930353 GGCCAGGGCCAATGTCCCTGAGG + Intronic
1169268440 20:4181671-4181693 GCCCCTGGTCTCTGTCCCTTAGG - Intronic
1171133024 20:22672804-22672826 GCCCAGTGCCTCTGTCCTTGGGG - Intergenic
1172009314 20:31837199-31837221 GCCCATGGCCCTGGTGCCTGTGG - Intergenic
1172443982 20:34983764-34983786 TCCCCTGCCCAATGTCCCTGTGG + Intronic
1172596170 20:36152772-36152794 GCCCAAGGCCACGGCCCCAGGGG + Intronic
1174131606 20:48348148-48348170 GCCAATAGAAACTGTCCCTGAGG - Intergenic
1175161579 20:57011782-57011804 GCCCAGGGGGACTGGCCCTGAGG - Intergenic
1175410455 20:58764318-58764340 CTCCATGCCAACTGTCCCTGGGG + Intergenic
1175855006 20:62116120-62116142 GAACATGCCCACTGTCCCAGCGG - Intergenic
1176415411 21:6471834-6471856 GGTCAGGGCCGCTGTCCCTGAGG - Intergenic
1177604677 21:23361887-23361909 ACACGTGGCCACTGACCCTGGGG + Intergenic
1178643290 21:34363867-34363889 GCCCAAAGCCAGAGTCCCTGAGG + Intergenic
1179112078 21:38455960-38455982 CCCCATGGCCAGTGGCCCTGTGG - Intronic
1179411012 21:41163280-41163302 GCCCATCGCCACTGTCCTCACGG + Intergenic
1179690911 21:43080167-43080189 GGTCAGGGCCGCTGTCCCTGAGG - Intergenic
1180138343 21:45875732-45875754 CCTCATGCCCACTGACCCTGAGG + Intronic
1180194393 21:46184213-46184235 ACCCATGGCCACGGCCCCTCGGG + Intronic
1183070687 22:35393942-35393964 GGCCATGACCACTTTCCCCGTGG + Exonic
1183395411 22:37568488-37568510 CCCCATGGACACTGTCCCAATGG + Exonic
1183547985 22:38465558-38465580 GGCCTTGGCCAGTTTCCCTGTGG + Intergenic
1184021357 22:41823868-41823890 GGCCAGGGCCACTGTCTGTGTGG - Intronic
1184101912 22:42345195-42345217 GCAGCTGGCCAGTGTCCCTGGGG + Intergenic
1184495545 22:44839148-44839170 CCCCAGGGACACTGTCTCTGTGG + Intronic
1184658794 22:45955822-45955844 GGCCTTGTCCACAGTCCCTGGGG - Intronic
1184697380 22:46147633-46147655 GCCCACGGCCCCTGCCCCGGTGG + Intergenic
1184829342 22:46974426-46974448 GCCCACGCCCACAGCCCCTGCGG + Intronic
1184911781 22:47540140-47540162 GCCTAGGTCCTCTGTCCCTGGGG - Intergenic
1185060095 22:48602212-48602234 CCCCATGCACACTGTCTCTGAGG - Intronic
949586777 3:5448403-5448425 GTCCATAGAAACTGTCCCTGAGG - Intergenic
949877217 3:8634271-8634293 GCCCATGGAGACTCACCCTGAGG + Intronic
951133677 3:19077977-19077999 CTCCCTGGCCACTGCCCCTGTGG + Intergenic
952358242 3:32604547-32604569 GGCCAGGGCCACTGTCTGTGTGG - Intergenic
953704106 3:45218455-45218477 TCCCATGCCCACTGACCCTCAGG + Intergenic
954409085 3:50362089-50362111 GCACCTGGCCAGTGTCCCTACGG - Intronic
954756380 3:52842610-52842632 ACCCATTCCCACTGTCCCTTGGG - Intronic
954864435 3:53717085-53717107 GCCCATGGGCTCTGCCCGTGTGG - Intronic
960062675 3:113340024-113340046 GCACATGTCCATTGGCCCTGTGG + Intronic
961143918 3:124578527-124578549 GCCCAAGGCCACTCACACTGTGG - Intronic
961167532 3:124773891-124773913 GGCCATGGCGAGTGTCACTGCGG - Exonic
961474401 3:127137633-127137655 GCCCAGGGGCACAGTGCCTGAGG - Intergenic
961810569 3:129519361-129519383 GCCCTTGGCCATGGTCCCTCGGG - Intronic
962390086 3:134964024-134964046 AGGCATGGCCACTGCCCCTGAGG - Intronic
964807280 3:160624651-160624673 GGCCTAGGCCACTGTCCATGTGG - Intergenic
967304388 3:188046375-188046397 GCCCATGGGCACAGCCCTTGTGG - Intergenic
968626806 4:1629493-1629515 GGCCATGGCCAGTGGCCCTCAGG - Intronic
968927587 4:3557902-3557924 CCCCCTGGCCCCTGCCCCTGGGG + Intergenic
969001944 4:3989506-3989528 GTCCATGGGCACAGGCCCTGTGG + Intergenic
969492987 4:7510493-7510515 GCCCATGGCCGCTGTCCTCTGGG - Intronic
969519342 4:7666675-7666697 GCCCATGGCCACAGTTCATGGGG + Intronic
969532106 4:7735846-7735868 TCCCATGGCCACTGCAACTGGGG + Intronic
969717778 4:8876679-8876701 GCCCATCTCCACTGTCTGTGGGG + Intergenic
973764379 4:54149822-54149844 GCCCACGGACACTCTCGCTGTGG + Intronic
973951128 4:56015467-56015489 GGGCAAGGCCACTGCCCCTGTGG + Intronic
974078628 4:57190875-57190897 GACCACGGCCTCTTTCCCTGTGG + Intergenic
981726554 4:147853268-147853290 GGCCAGGGCCACTGTCCGTGTGG - Intronic
982240547 4:153295581-153295603 GCCCGTGGCCACTGTCTCTGAGG - Exonic
983640519 4:169940639-169940661 GCCTTTGGCCAGTGTCCATGAGG + Intergenic
984570506 4:181387148-181387170 CCTCATGGCCACTGTGCCGGGGG - Intergenic
985868422 5:2534567-2534589 CCCCAAGGCCACTGTGCCAGAGG - Intergenic
985992864 5:3577887-3577909 GCCCATGGCCCCTCTCCCTTGGG + Intergenic
986203904 5:5605188-5605210 ATCCATGGCCACTGTCCTTCGGG + Intergenic
987466205 5:18275143-18275165 TCCCTTCGCCACTGTCCCTCAGG + Intergenic
989718528 5:44494736-44494758 GGTCATGGCCACTGTCTGTGTGG - Intergenic
989973116 5:50548269-50548291 CCCCATTGCCACTTTCCCTTAGG + Intergenic
990966223 5:61450842-61450864 GACCATGGCAAATGTTCCTGGGG - Intronic
990978095 5:61576581-61576603 GCCCATGGCCACTAACACAGGGG + Intergenic
996340937 5:122438220-122438242 AGCCAGGGCCACTGTCCCTGTGG + Intronic
999711142 5:154319691-154319713 GCCCTAGGCCCCTTTCCCTGTGG + Intronic
1002076153 5:176709723-176709745 GCCCATGGGCACTGCCTCAGAGG - Intergenic
1002730842 5:181330978-181331000 GGGCACGGCCACTGCCCCTGGGG - Intergenic
1002776475 6:332338-332360 GCCCCTGCCCACAGTCGCTGGGG - Intronic
1005320009 6:24644065-24644087 GGCCAGGGCCACTGTCTATGTGG + Intronic
1006214638 6:32429927-32429949 GGCCAGGGCCACTGTCCATGAGG - Intergenic
1006348462 6:33502791-33502813 GGCCAGCGCCACTGGCCCTGGGG + Intergenic
1006502386 6:34466814-34466836 GCCCATGGCTTCTGTATCTGCGG - Intronic
1007149252 6:39671806-39671828 GGCCAGGGCCACTGTCTGTGTGG + Intronic
1007799997 6:44384203-44384225 GGCCAGGGCCACTGTCTGTGTGG - Intergenic
1010178350 6:73055640-73055662 GCCCATGGCAACAGCCTCTGGGG + Intronic
1012031705 6:94076585-94076607 CTCCATGGGCACTGTACCTGAGG + Intergenic
1012860317 6:104551591-104551613 GCCCAACCCCACTGTCCCAGTGG + Intergenic
1017228577 6:152047881-152047903 ATCCAGGGCCACTGTGCCTGGGG + Intronic
1019136439 6:169911552-169911574 CCCCCAGGCCAGTGTCCCTGCGG - Intergenic
1019623267 7:2002865-2002887 GCCCTGGGCCTCTGCCCCTGCGG + Intronic
1023722686 7:43112742-43112764 GGCCACGGCCACTGTCACGGCGG - Exonic
1024075826 7:45817372-45817394 GCCCATGGCCCCCACCCCTGGGG - Intergenic
1026914606 7:74112321-74112343 GCCCATGGCCACTCTGCCATGGG - Intronic
1027217382 7:76192709-76192731 CCCCAAGGCCACTGGCCCAGGGG + Intergenic
1029775502 7:102681945-102681967 GCCTCTGCCCACAGTCCCTGAGG - Intergenic
1035096644 7:156361396-156361418 GGCCAGGCCCACTGCCCCTGCGG - Intergenic
1035179539 7:157079171-157079193 TCAAATTGCCACTGTCCCTGCGG + Intergenic
1035278588 7:157763381-157763403 CCCCATGGCCACAGTGACTGGGG - Intronic
1036220024 8:6913789-6913811 GCCCAAGCCTACTGGCCCTGAGG + Intergenic
1038613224 8:29072037-29072059 GTCCATGCCCACCGCCCCTGAGG - Exonic
1039983280 8:42427286-42427308 GACCATGGCCAAGGTGCCTGGGG - Intronic
1040109348 8:43559911-43559933 CCGCCTGGCCACTCTCCCTGAGG + Intergenic
1040594195 8:48821844-48821866 GCCCATGGGCACTGTCAGGGTGG + Intergenic
1041641729 8:60209857-60209879 GCTGATGGGCAATGTCCCTGAGG - Intronic
1046447017 8:114336183-114336205 GCCAATGCCCACTGTACTTGTGG + Intergenic
1046633226 8:116643157-116643179 GGCCATGGCCCCTGCCCTTGTGG - Exonic
1049003358 8:139839787-139839809 GGCCATGCCCACTCTCCCTTTGG - Intronic
1049254093 8:141604799-141604821 GACCATGGCCAGTGCCCCTATGG + Intergenic
1049844170 8:144792124-144792146 GCCCATGGCGACGGGTCCTGGGG + Exonic
1053802444 9:41772981-41773003 CCCCCTGGCCTCTGCCCCTGGGG + Intergenic
1054142794 9:61542089-61542111 CCCCCTGGCCTCTGCCCCTGGGG - Intergenic
1054190753 9:61984327-61984349 CCCCCTGGCCTCTGCCCCTGGGG + Intergenic
1054647621 9:67603390-67603412 CCCCCTGGCCTCTGCCCCTGGGG - Intergenic
1056445005 9:86656924-86656946 GGCCAAGGGCAATGTCCCTGTGG + Intergenic
1060594430 9:124839876-124839898 GCCCAGGGCCCCTGTGTCTGGGG - Intergenic
1060722106 9:125986345-125986367 GCCCATGGCAGGGGTCCCTGGGG - Intergenic
1061033707 9:128101920-128101942 GCCCAGGGCTGCTGTCCCCGAGG - Intronic
1061068302 9:128292995-128293017 GCCTGGGGCCACTGTCACTGAGG - Intergenic
1061698008 9:132392455-132392477 GCTCAGAGCCTCTGTCCCTGTGG + Intronic
1061731884 9:132621530-132621552 GCCCATGGTAAATGTCCCTTTGG - Intronic
1062121355 9:134835660-134835682 GCCCATGGGCCCTCTCCATGTGG + Intronic
1062346401 9:136117268-136117290 TCCCCTGGCCACTGTCCCCAAGG - Intronic
1185529285 X:804726-804748 TCCCTGGGACACTGTCCCTGGGG - Intergenic
1189294388 X:39908483-39908505 GCCCCTGGCAAATTTCCCTGAGG - Intergenic
1189334861 X:40164979-40165001 GCCCATGGACCCTGACCCTCAGG + Intronic
1189407183 X:40735597-40735619 GCCCCTCGCTCCTGTCCCTGGGG - Intronic
1189507309 X:41624861-41624883 GCCCAGGGCCTCAGTCCCAGTGG + Intronic
1192203510 X:69081878-69081900 TCCCATGGACACTGCCTCTGGGG - Intergenic
1195770627 X:108347310-108347332 CCCCAGGGCCACTGCCCATGTGG - Intronic
1195961686 X:110393752-110393774 GTCCATGGACAGTGGCCCTGGGG - Intronic
1197690447 X:129494981-129495003 GGCCAGGGCCACTGTCCATATGG + Intronic
1198711345 X:139507812-139507834 GCCCATGGGCACAGGCCCAGAGG - Intergenic
1202018426 Y:20435720-20435742 CCCCATGCCCCGTGTCCCTGAGG - Intergenic