ID: 1063352964

View in Genome Browser
Species Human (GRCh38)
Location 10:5373570-5373592
Sequence CGGGCTGATGCTGCTGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 972
Summary {0: 1, 1: 2, 2: 20, 3: 180, 4: 769}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063352955_1063352964 14 Left 1063352955 10:5373533-5373555 CCTGAGAATTATTTGCATTTCTA 0: 1
1: 1
2: 7
3: 156
4: 2592
Right 1063352964 10:5373570-5373592 CGGGCTGATGCTGCTGGTCTGGG 0: 1
1: 2
2: 20
3: 180
4: 769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063352964 Original CRISPR CGGGCTGATGCTGCTGGTCT GGG Intronic
900152668 1:1185481-1185503 CGGGCAGCTGCTGCTGCTCCAGG - Intronic
900207277 1:1436923-1436945 GGGGCTGATGCTGGTGGACCTGG - Exonic
900310216 1:2029869-2029891 GGGGCTGGAGCTGCTGGTCCAGG + Intronic
900449931 1:2700881-2700903 CGGGGTGAAGGTGCTGTTCTAGG - Intronic
900450184 1:2702127-2702149 CGGGGTGAGGGTGCTGTTCTAGG - Intronic
900453388 1:2761832-2761854 CGGGGTGAAGGTGCTGTTCTAGG - Intronic
900453668 1:2763238-2763260 CGGGGTGAGGGTGCTGTTCTAGG - Intronic
900454040 1:2765170-2765192 CGGGGTGAAGGTGCTGTTCTAGG - Intronic
900454381 1:2766823-2766845 CGGGGTGAGGGTGCTGTTCTAGG - Intronic
900454804 1:2769044-2769066 CGGGGTGAGGGTGCTGTTCTAGG - Intronic
900455113 1:2770500-2770522 CGGGGTGAGGGTGCTGTTCTAGG - Intronic
900455487 1:2772432-2772454 CGGGGTGAAGGTGCTGTTCTAGG - Intronic
900455859 1:2774245-2774267 CGGGGTGAGGGTGCTGTTCTAGG - Intronic
900456342 1:2776788-2776810 CGGGGTGAGGGTGCTGTTCTAGG - Intronic
900642350 1:3693798-3693820 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642381 1:3693903-3693925 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642403 1:3693974-3693996 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642454 1:3694149-3694171 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642477 1:3694220-3694242 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642533 1:3694397-3694419 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642564 1:3694502-3694524 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642595 1:3694607-3694629 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900642684 1:3694923-3694945 GGGGCTGAGGCTGCAGGGCTGGG - Intronic
900741183 1:4332339-4332361 TGGGCTGGTGCTGCAGGTCGTGG - Intergenic
900884211 1:5403936-5403958 AGGGCTGCTGCTGCTGGTGCTGG - Intergenic
901245299 1:7725685-7725707 AGTTCTGATGCTTCTGGTCTAGG - Intronic
902211365 1:14907029-14907051 GTTGCTGATGCTGCTGGTCTTGG - Intronic
902271890 1:15310582-15310604 GATGCTGATGCTGCTGGTCCAGG - Intronic
902293997 1:15453843-15453865 TGTGCTGATGCTGCTGGCCCAGG + Intergenic
902931811 1:19736674-19736696 AGGGCTGCTGCTCCTGGCCTTGG - Intronic
903288318 1:22290979-22291001 CTGGCTGATGTCGCTGGTGTGGG + Intergenic
903457080 1:23495029-23495051 AATTCTGATGCTGCTGGTCTGGG + Intergenic
903831852 1:26180229-26180251 GAGTCTGCTGCTGCTGGTCTGGG + Intronic
904974069 1:34442579-34442601 GATGCTGATGCTGCTGGTCTGGG + Intergenic
904975230 1:34451093-34451115 GATGCTGATGCTGCTGGTCCAGG - Intergenic
905111939 1:35601759-35601781 GCTACTGATGCTGCTGGTCTAGG - Exonic
905214376 1:36396600-36396622 GATGCTGATGCTGCTGGTCAGGG + Intronic
905556408 1:38888687-38888709 GAAGCTGATGCTGCTGGTCTTGG - Intronic
905588479 1:39141377-39141399 GATGCTGATGCTGCTGGTCTGGG + Intronic
905832969 1:41089080-41089102 AGTGCTGATGCTGCTGGTCTGGG + Intronic
905903265 1:41596280-41596302 CGCACTGCTGCTGCTGGGCTGGG + Intronic
907002854 1:50879693-50879715 GATGCTGATGCTGCTGGTCTAGG - Intronic
907376047 1:54041447-54041469 TTTGCTGATGCTGCTGGCCTGGG - Intronic
907634898 1:56124596-56124618 AAGGCTGATGCTGCTGGTCCAGG - Intergenic
907824136 1:57999317-57999339 GCTGCTGATGCTGCTGGTCCAGG - Intronic
907952582 1:59197843-59197865 AAAGCTGATGCTGCTGGTCCAGG + Intergenic
909068138 1:70961057-70961079 AATGCTGATGCTGCTGATCTGGG + Intronic
911213752 1:95169254-95169276 CATGCTGATGCTGCTTATCTGGG + Intronic
912719284 1:112006140-112006162 CAAGTTGATGCTGCTGGTCTAGG + Intergenic
913070294 1:115292472-115292494 GATGCTGATGCTGTTGGTCTGGG + Intronic
913147824 1:116009504-116009526 CTGCCTGGTGCTGCTGGCCTTGG - Intronic
913181380 1:116325770-116325792 GATTCTGATGCTGCTGGTCTGGG - Intergenic
913312283 1:117512473-117512495 GATGCTGATGCTGCTGGTCTGGG + Intronic
914787151 1:150844524-150844546 GTTGCTGATGCTCCTGGTCTCGG - Intronic
915079488 1:153342041-153342063 CTGGCGGGTGCTGCTGGGCTTGG - Intronic
915487494 1:156232000-156232022 TAGGCTGATGGTGCTGGTCTGGG - Intronic
915637325 1:157195814-157195836 TGGGCTGCTGCAGCTGGCCTGGG - Intergenic
916250758 1:162735524-162735546 GATGCTGATGCTGCTGGTCCTGG + Intronic
916411324 1:164550031-164550053 CAGGTTTAAGCTGCTGGTCTGGG - Intergenic
916488405 1:165279606-165279628 GGGGCTGATGCTGCCTGTCCAGG + Intronic
916888373 1:169092499-169092521 CATGCTGATGCTGCTGGTCTGGG + Intergenic
917369899 1:174281195-174281217 CGGGTTGCTGCTGCTGGCTTAGG + Intronic
917732675 1:177891793-177891815 GTGGCTCAGGCTGCTGGTCTAGG - Intergenic
918594668 1:186279186-186279208 GATGCTGATGCTGCTGGTCCAGG - Intergenic
919201247 1:194358022-194358044 CGGGCTGACGCTGCTGGCTCGGG + Intergenic
919851728 1:201677432-201677454 TGGGCAGAGGCTGCTGGCCTTGG - Intronic
920123058 1:203673156-203673178 TGAGCTGATGCATCTGGTCTGGG - Intronic
920187042 1:204166242-204166264 GGGACTGCTGCTGCTGCTCTGGG - Exonic
920281856 1:204849533-204849555 TCTGCTGATGCTGCTGGTCCAGG + Intronic
920695331 1:208177738-208177760 GGGGCAGATGCTGCTGCTCTGGG - Intronic
920738813 1:208560581-208560603 CATGCTGAAGATGCTGGTCTGGG + Intergenic
920854384 1:209651395-209651417 TGGGTTGAGGCTGCTGGTCTAGG - Intronic
921118099 1:212113524-212113546 GGTGCTGATGCTGCTGGTCTAGG + Intergenic
921505589 1:215965121-215965143 GTGGCTGTTGCTGCTGCTCTGGG + Intronic
921878657 1:220228463-220228485 CTGGTTGATGCTGCTGTTCAAGG + Intronic
921900063 1:220440694-220440716 GAAGCTGATGCTGCTGGTCCAGG + Intergenic
922033090 1:221823361-221823383 GATGCTGATGCTGCTGGTCCAGG + Intergenic
923036801 1:230290196-230290218 GATGCTGATGCTGCTGGCCTGGG + Intergenic
923631505 1:235651627-235651649 CACGCTGATTCTACTGGTCTTGG - Intergenic
923763534 1:236870546-236870568 AGGGCTGGTGCTGCTGGTACAGG + Intronic
924574520 1:245267888-245267910 CAGCCTGATGCTGGTTGTCTGGG + Intronic
924756458 1:246945703-246945725 CGGGCTGACGCAGCTGGACCCGG + Intronic
1063352964 10:5373570-5373592 CGGGCTGATGCTGCTGGTCTGGG + Intronic
1064137366 10:12762623-12762645 CGTGATGAGGATGCTGGTCTGGG + Intronic
1065738610 10:28776174-28776196 GGTGCCAATGCTGCTGGTCTAGG + Intergenic
1065748190 10:28860963-28860985 GGGGCTGCTGCTCCTGGTGTAGG - Intronic
1067062834 10:43086796-43086818 CAGGCCGCTGCAGCTGGTCTGGG + Intronic
1067284741 10:44899297-44899319 TGGGCTGATGCCGTTGGTCCTGG + Intergenic
1067791644 10:49292886-49292908 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1067851656 10:49758693-49758715 TGGGCAGATGGTGCTGGGCTAGG + Intronic
1068095605 10:52487440-52487462 GAAGCTGATGCTGCTGGTCTAGG + Intergenic
1068729303 10:60338431-60338453 GATGCTGATGCTGCTGGCCTAGG + Intronic
1068800893 10:61138574-61138596 GATTCTGATGCTGCTGGTCTTGG + Intergenic
1069287887 10:66739347-66739369 GATGCTGATGCTGCTGCTCTGGG + Intronic
1069574546 10:69517363-69517385 CTTGCTGATGGTGTTGGTCTGGG - Intergenic
1069742490 10:70693894-70693916 AGCGCTGATGGTGCTGGTATGGG + Intronic
1069860368 10:71467432-71467454 GATGGTGATGCTGCTGGTCTGGG + Intronic
1069879678 10:71583954-71583976 GATGCTGATGCTGCTGCTCTGGG - Intronic
1069879695 10:71584057-71584079 AACACTGATGCTGCTGGTCTGGG + Intronic
1069945163 10:71980668-71980690 GGGGCTGATACTGCCAGTCTGGG + Intronic
1070390086 10:75962332-75962354 GATGCTGATGCTGCTGGGCTGGG - Intronic
1070489477 10:76963257-76963279 GATGCTGATGCGGCTGGTCTGGG - Intronic
1070742676 10:78913115-78913137 GATGCTGATGCTGCTGGTCCTGG + Intergenic
1070829042 10:79407564-79407586 GGTGCAGCTGCTGCTGGTCTGGG + Intronic
1071241302 10:83708213-83708235 GAGGCTGATTCTGCTGGGCTGGG + Intergenic
1071509807 10:86254360-86254382 GATGCTGGTGCTGCTGGTCTGGG - Intronic
1072096025 10:92180792-92180814 AATGCTGATGCTGCTGGTCCAGG + Intronic
1072479320 10:95795297-95795319 CAGGATGATGCTGCTGTTCTTGG + Intronic
1072576377 10:96704383-96704405 GATGCTGATGCTGCTGGTCCAGG - Intronic
1072978029 10:100076030-100076052 CGAGCTGATGCTGCAGCTGTCGG - Exonic
1073142968 10:101261202-101261224 CGGCCAGAGGCTGCTGGCCTGGG + Intergenic
1073417161 10:103393969-103393991 GATGCTAATGCTGCTGGTCTAGG - Intronic
1073739948 10:106394879-106394901 AGGGCTGGTGCTGCTGGTCTGGG + Intergenic
1074143300 10:110695996-110696018 GATGCTGATGCTGCTGGTCCAGG - Intronic
1074703451 10:116111720-116111742 AGTGCTGCTGCTGCTGGTCTGGG - Intronic
1074963750 10:118470892-118470914 GATGTTGATGCTGCTGGTCTGGG + Intergenic
1075226788 10:120636806-120636828 GATGCTGATGCTGCTGATCTAGG + Intergenic
1075329256 10:121560932-121560954 GATGCTGATGCTGCTGGTCCAGG + Intronic
1075930703 10:126293012-126293034 GATGCTGATGCTGCTGGTCTGGG + Intronic
1075955294 10:126518198-126518220 CGTGTGGATGCTGCTGGTCTGGG - Intronic
1076137553 10:128055500-128055522 CGTGCTGATTCTGTGGGTCTGGG + Intronic
1077015153 11:396042-396064 CGGGCTGACGCAGCTGCCCTTGG + Intronic
1077142710 11:1031440-1031462 CTGGCTCATGTTGCTGGTCAGGG + Intronic
1077397072 11:2329973-2329995 CCGGGTGATGCAGCTGGTCCAGG - Intergenic
1077886437 11:6390975-6390997 GGGGCTGATGCTGGTGCGCTGGG + Intronic
1077951501 11:6962668-6962690 GATGTTGATGCTGCTGGTCTGGG - Intronic
1079316389 11:19411188-19411210 CCAGGTGATGCTGCTGCTCTGGG + Intronic
1079366190 11:19812222-19812244 CATGCTAATGCTGCTGGTCTGGG + Intronic
1080743693 11:35088586-35088608 CTGGGTGATTCTGCTGATCTTGG - Intergenic
1080874267 11:36262110-36262132 CTGCCTGGTGCTGCTGGGCTTGG + Intergenic
1080923260 11:36730336-36730358 AAGGCTGATGCTGCTAGTCTGGG - Intergenic
1081078125 11:38701505-38701527 CCTGCTGCTGCTGCTGCTCTGGG - Intergenic
1081483189 11:43507571-43507593 GATGCTGATGCTGTTGGTCTGGG - Intergenic
1081855439 11:46300405-46300427 CCAGGTGATGCTGCTGGTCTGGG - Intronic
1082243411 11:49893075-49893097 GAGGCTGATGCTGCTGGCCCAGG - Intergenic
1084697042 11:70761925-70761947 GCTGCTGCTGCTGCTGGTCTGGG + Intronic
1085192398 11:74639121-74639143 AATGCTGATGCTGCTGGTCTGGG - Intronic
1085400272 11:76231895-76231917 CACGCTGAAGCTGCTGGTGTGGG + Intergenic
1085442608 11:76578104-76578126 GGGTCTGATGCTGCTGGCCCTGG + Intergenic
1085799205 11:79572539-79572561 GATGCTGATGCTGCTGGCCTGGG + Intergenic
1085911308 11:80829913-80829935 AGGACTGATGCTGTTGGTCTGGG + Intergenic
1086076768 11:82863057-82863079 GAAGCTGATACTGCTGGTCTGGG - Intronic
1086279092 11:85164917-85164939 GGTGCTGATGCTGCTGGTCTGGG - Intronic
1086279183 11:85166010-85166032 GGCGCTGATGCTGCTGGTCTGGG - Intronic
1086825940 11:91496708-91496730 GTTCCTGATGCTGCTGGTCTGGG - Intergenic
1086980084 11:93186946-93186968 GCTGCTGATGTTGCTGGTCTGGG + Intronic
1087275867 11:96159855-96159877 GATACTGATGCTGCTGGTCTGGG + Intronic
1087760772 11:102102189-102102211 GATGCTGATGCTGCTGGTTTAGG + Intergenic
1087837759 11:102891867-102891889 AAGGCTGATGCTGCTGGTCTGGG - Intergenic
1087866241 11:103229947-103229969 GATGCTGATGCTGCTGGTCTAGG - Intronic
1088574039 11:111252412-111252434 AATGCTGATGCTGCTGGTCCAGG + Intergenic
1088753112 11:112862501-112862523 GGAGCTGATGCTACTGCTCTAGG - Intergenic
1088911305 11:114194429-114194451 CGGGCTCAAGCTGGTGTTCTAGG + Intronic
1089626449 11:119754159-119754181 GATGCTGATGCTTCTGGTCTCGG - Intergenic
1089634362 11:119802991-119803013 CGAGGTCATGCTGCTGGTCAGGG - Intergenic
1090561760 11:127940069-127940091 ATTGCTGATACTGCTGGTCTGGG + Intergenic
1091031368 11:132191187-132191209 AGTGCTGTTGCTGGTGGTCTGGG + Intronic
1091841517 12:3624737-3624759 GAGGCTGATGCTGGTGGTCCAGG - Intronic
1091920064 12:4296929-4296951 GGGGTTGAAGCTGCTGTTCTGGG + Intronic
1092771084 12:11897357-11897379 AGTGCTGATGGTGCTGGTCCAGG + Intergenic
1093115560 12:15206518-15206540 GATGCTGATGCTGCTAGTCTAGG - Intronic
1094343254 12:29436923-29436945 CGGGTTGCTGCTGCTGGCCCCGG + Intronic
1094487634 12:30937697-30937719 GAGGCTGATGCTGTTGGTCTGGG - Intronic
1094720910 12:33063157-33063179 CGGGCTGTTGCTGCTGGGACAGG + Intergenic
1095792727 12:46185239-46185261 GATGCTGATGCTACTGGTCTAGG + Intronic
1095902912 12:47346951-47346973 GATGTTGATGCTGCTGGTCTGGG + Intergenic
1096417247 12:51424933-51424955 CGGGCTGCTGATGCTTGGCTTGG + Exonic
1097301545 12:58024480-58024502 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1098440384 12:70511513-70511535 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1098864022 12:75741678-75741700 CTGCCCGAAGCTGCTGGTCTGGG - Intergenic
1100207395 12:92365401-92365423 AAGGCTGATTCTGCTGGTCCTGG + Intergenic
1100243454 12:92732962-92732984 CCCGCTGCTGCTGCTGGTCGTGG - Intronic
1100565427 12:95790276-95790298 CGCGCGGCTGCTGCTGCTCTGGG - Exonic
1101089794 12:101273606-101273628 GGTGCTGATACTGCTGGTCAGGG + Intergenic
1101706719 12:107227406-107227428 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1101740144 12:107494367-107494389 TGGGCTGAGTCTGCTGGTCAGGG + Intronic
1102009828 12:109611511-109611533 CGGGCTGTGGCTGCTGCTGTTGG - Intergenic
1102202272 12:111065760-111065782 GATGCTGATGCTGCTGGTCCAGG - Intronic
1102494171 12:113307706-113307728 GGGGCTCACGCTGCTGGCCTGGG - Exonic
1102560078 12:113755645-113755667 TGGGCTGGCTCTGCTGGTCTTGG - Intergenic
1102623810 12:114218472-114218494 TGATCTGATGCTACTGGTCTGGG + Intergenic
1102624847 12:114226738-114226760 GGCGCTGATGCTGCTGGCCCAGG + Intergenic
1102962378 12:117100903-117100925 GGGGCTGATTCTGATGCTCTAGG - Intergenic
1102977625 12:117217930-117217952 GGTGCTGATGCTGCTGTTTTGGG + Intronic
1103065003 12:117890108-117890130 GATGCTGATGCTGCTGGTCCAGG + Intronic
1103359809 12:120346850-120346872 ATGGCTGATGCTGCTGCACTAGG - Intronic
1103618493 12:122170971-122170993 CGGGCTGCTGCTGCTGCTGCTGG + Intronic
1103759734 12:123240029-123240051 GAGGCTGTTGCTGCTGGTCCAGG - Intronic
1103972627 12:124681693-124681715 CCGGCGGATGCTGCTGGCCTGGG - Intergenic
1104004911 12:124885101-124885123 CACGCTGGTGCTGCTGGTCTGGG + Intergenic
1104488105 12:129169214-129169236 GATGCTGATGCAGCTGGTCTGGG + Intronic
1105988706 13:25595828-25595850 GGGTCTGATGCTGCTGGCCAAGG + Intronic
1107095495 13:36530824-36530846 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1107434748 13:40372483-40372505 TAGGCTGAAGCTGCTGGTCCAGG - Intergenic
1107583563 13:41818910-41818932 GATACTGATGCTGCTGGTCTGGG - Intronic
1108095111 13:46893403-46893425 GATGCTGATGCTGCTGGTCCAGG + Intronic
1108235802 13:48403755-48403777 GATACTGATGCTGCTGGTCTGGG + Intronic
1108379665 13:49843963-49843985 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1108382686 13:49869233-49869255 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1108575817 13:51789503-51789525 GATGCTGAGGCTGCTGGTCTGGG + Intronic
1108772963 13:53727839-53727861 GATGTTGATGCTGCTGGTCTAGG + Intergenic
1109309240 13:60672462-60672484 GTGGCTCAGGCTGCTGGTCTGGG + Intergenic
1110121249 13:71884544-71884566 TGGGATGACGCTTCTGGTCTGGG + Intergenic
1110278975 13:73670667-73670689 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1110416266 13:75256542-75256564 AATGCTGATGCTGCTGGTCCAGG - Intergenic
1111934942 13:94548960-94548982 GGTGCTGATGCTGCGGATCTGGG + Intergenic
1111962122 13:94823292-94823314 TGTGCTTATGGTGCTGGTCTGGG - Intergenic
1112353474 13:98655525-98655547 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
1112366000 13:98756001-98756023 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1112372177 13:98803555-98803577 GGTGCTGATGCTGCTGGTCCTGG + Intronic
1112551857 13:100428741-100428763 CCAGGTAATGCTGCTGGTCTGGG + Intronic
1112781367 13:102904466-102904488 GATGCTGATGCTCCTGGTCTGGG + Intergenic
1113265855 13:108617295-108617317 GGGGATGCTGCTGCTGGTCCAGG + Intronic
1113544445 13:111137279-111137301 AGTGCTGGTGCTGCTGGTCCTGG + Intronic
1114172488 14:20287295-20287317 GATGCTGATGCTGCTGGTCTGGG + Exonic
1114452579 14:22836900-22836922 GGGGCTGAAGCTGCTGCTTTGGG - Exonic
1114512710 14:23275900-23275922 CGGGTTGATGGTGGTGGTGTAGG + Exonic
1115179384 14:30604590-30604612 GCTGCTGCTGCTGCTGGTCTGGG + Intronic
1115550717 14:34502765-34502787 GGTGCTGATTCTGCTGGTCTGGG + Intergenic
1116243059 14:42371453-42371475 CTGGCTTATGCTGGTTGTCTTGG + Intergenic
1117021030 14:51570596-51570618 GGTGTTGATGCTGCTGGTCTGGG - Intronic
1117408614 14:55429288-55429310 CCAGGTGAAGCTGCTGGTCTGGG - Intronic
1118621520 14:67618708-67618730 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1119628660 14:76206652-76206674 TGTGCTGATGCTGTTGGCCTAGG - Exonic
1119706024 14:76783064-76783086 GGGGCTAATGCCGCTGGGCTGGG - Intergenic
1119943655 14:78668540-78668562 AGGGAAGATGCTGCTGGTGTGGG + Intronic
1121080061 14:91100662-91100684 GAGGCTGGTGCTGCTGGTCTGGG - Intronic
1121098414 14:91233708-91233730 CAGGCTGGGGCTGCTGGTCGGGG - Exonic
1121226542 14:92325317-92325339 GGTGCTGATTCTGCTGGTCCAGG - Intronic
1121265374 14:92599086-92599108 CCAGCTGATGCTCCTGTTCTCGG - Intronic
1121451472 14:94010999-94011021 GTGGCAGATGCTGCTGGTCCTGG + Intergenic
1122703777 14:103607733-103607755 CGAGCTGACCCTGGTGGTCTGGG - Intronic
1122738700 14:103858489-103858511 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
1123194926 14:106606829-106606851 TGTGCTGAAGATGCTGGTCTGGG + Intergenic
1123920401 15:25065877-25065899 CGGGCTGATGCCTGTGGTCCTGG + Intergenic
1124430457 15:29603286-29603308 GCTGCTGATGCTGCTGTTCTGGG - Intergenic
1124645956 15:31437671-31437693 GGGGCTGAGGCTGCTGGCCAGGG + Intergenic
1125511109 15:40292878-40292900 CAGGCTCCTGCTGCTGATCTTGG + Intronic
1125968551 15:43893700-43893722 GGGGCTGAGGCTGCTGGGCCAGG + Intronic
1126141502 15:45443099-45443121 GAAGCTGATGCTCCTGGTCTGGG + Intronic
1126924062 15:53562491-53562513 GATGCTGATGCTGCTGGTCCAGG + Intronic
1126994225 15:54421470-54421492 CTAGCTGATGCTGCTGGTCCAGG - Intronic
1127001723 15:54516451-54516473 GACGCTGATGCTACTGGTCTGGG + Intronic
1127377554 15:58398871-58398893 AACGCTGATGCTGCTGGTCTAGG - Intronic
1127386086 15:58468332-58468354 GATGCTGATGCTGCTGGTTTGGG - Intronic
1127428576 15:58880428-58880450 GGTGCTGCTGCTGCTGGTTTGGG - Intronic
1127473672 15:59312684-59312706 GTTGCTGATGCTGCTGGTTTGGG - Intronic
1127592564 15:60440577-60440599 CGTACTGATGCTGCTAGTTTAGG - Intronic
1127638675 15:60894731-60894753 GGAGCTGATGCTGCTGGCCTGGG + Intronic
1127822105 15:62667291-62667313 CAGGTGGATGCTGCTGGTCCTGG + Intronic
1128231548 15:66038996-66039018 CCTGCTGGTGCTGCTGGCCTGGG - Intronic
1128234141 15:66056018-66056040 GGTGCTGCTGCTGCTGGTTTAGG - Intronic
1128343336 15:66837740-66837762 GGTGCTGATGCTGCCAGTCTAGG + Intergenic
1128350653 15:66886236-66886258 TGGGCTGAGGCTGGTGGTGTTGG - Intergenic
1128397835 15:67246902-67246924 CGGGTTGCTGCTGCTGGCTTGGG - Intronic
1128522941 15:68387392-68387414 GGTGCTGGTGCTGCTGGTCTGGG - Intronic
1128841589 15:70854706-70854728 GCAGCTGATGCTCCTGGTCTGGG - Intronic
1129274034 15:74433804-74433826 GCGGCTGCTGCTGCTGCTCTGGG - Exonic
1129760352 15:78125589-78125611 GAGGCTGATGCTGCTGGTCCAGG - Intronic
1130795106 15:87199510-87199532 AATGCTGATGCTGCTGGTCCTGG + Intergenic
1131384131 15:91988727-91988749 GATGCTGATGCTGCTGGTCCAGG + Intronic
1131439949 15:92452199-92452221 GATGCTGATGCTGCTGGTCTGGG - Intronic
1131481647 15:92787427-92787449 GATGCTGATGGTGCTGGTCTGGG - Intronic
1131514747 15:93069756-93069778 AAGGCTAATGCTGCTGGTCCAGG + Intronic
1131643726 15:94319543-94319565 AAGGCTGATGCTGCTGGCCCAGG + Intronic
1131670056 15:94610341-94610363 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1131793207 15:95987452-95987474 GAGGCTGCTGCTGCTGGTCAGGG - Intergenic
1132252122 15:100341839-100341861 CGTGCTGCTGCTGCTGGTTTGGG - Exonic
1132319293 15:100913766-100913788 GAGGCTGATGCTGCTGGTCTGGG + Intronic
1133011170 16:2912438-2912460 GGGGCTGATGCTGCGGGTCCAGG - Intronic
1133033749 16:3023593-3023615 CTGGCTGATGCTGCAGGCTTAGG - Intronic
1133401658 16:5492021-5492043 AACGCTGATACTGCTGGTCTGGG - Intergenic
1133726834 16:8545671-8545693 GAGGCTGATGCTGCTGATCTGGG + Intergenic
1133799518 16:9073770-9073792 GGCGCTGAAGCTGCTGGTCCTGG + Intergenic
1133907527 16:10035664-10035686 GATGCTGATGCTGCTGGTCCAGG + Intronic
1134084445 16:11346721-11346743 GATGCTGATGCTGCTGGTCTGGG + Intronic
1134438751 16:14285166-14285188 CCAGGTGCTGCTGCTGGTCTTGG + Intergenic
1134502725 16:14781730-14781752 ATGGCAGATGCTGCTGGCCTGGG - Intronic
1134567706 16:15265615-15265637 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1134577838 16:15347165-15347187 ATGGCAGATGCTGCTGGCCTGGG + Intergenic
1134630466 16:15752473-15752495 CCAGGTGATGCTGCTGGTCTAGG - Intronic
1134724750 16:16410381-16410403 ATGGCAGATGCTGCTGGCCTGGG - Intergenic
1134734731 16:16490738-16490760 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1134751694 16:16630299-16630321 GATGCTGGTGCTGCTGGTCTGGG + Intergenic
1134761520 16:16718944-16718966 GGTGCTGATGCTGCTGGCCCAGG - Intergenic
1134932742 16:18221168-18221190 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1134942682 16:18301478-18301500 ATGGCAGATGCTGCTGGCCTGGG + Intergenic
1134984538 16:18640226-18640248 GGTGCTGATGCTGCTGGCCCAGG + Intergenic
1134993766 16:18723324-18723346 GATGCTGGTGCTGCTGGTCTGGG - Intergenic
1135046317 16:19158912-19158934 GATGCTGATGCTGCTGGTCCAGG + Intronic
1135183603 16:20295879-20295901 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1136928423 16:34396547-34396569 GACGCTGATGTTGCTGGTCTAGG - Intergenic
1136976151 16:35015257-35015279 GACGCTGATGTTGCTGGTCTAGG + Intergenic
1137036782 16:35575042-35575064 CGTGCTGATGCTGCTGATAGTGG + Intergenic
1137715420 16:50595449-50595471 TGGCCTGATGCTGGTGGTCCTGG + Intronic
1138292552 16:55860358-55860380 GATGCTGATGCTGCTGGTCTAGG - Intronic
1138556921 16:57776188-57776210 CAGGCTGAAGCTGCTGAGCTGGG + Intronic
1138645150 16:58419243-58419265 GGTGCTGATGCAGCTGGCCTGGG - Intergenic
1138939439 16:61772751-61772773 GAGGCTGATGCTGCAGGTCCAGG - Intronic
1139523046 16:67496239-67496261 TAGGCTGATGCTGTTGGTGTGGG - Intergenic
1140221472 16:73047684-73047706 CGGGCAGGTGCTGCGAGTCTTGG - Intronic
1140687929 16:77451450-77451472 GATGCCGATGCTGCTGGTCTGGG - Intergenic
1140725744 16:77810253-77810275 AATGCTGATGCTGCTGATCTGGG - Intronic
1140951298 16:79820403-79820425 GGTGTTGATGCTGCTGGTCTAGG + Intergenic
1141012597 16:80416906-80416928 GTTGCTGATGCTGCTGGTCCAGG + Intergenic
1141090064 16:81124023-81124045 GATGCTGATGCTGCTGGTGTGGG - Intergenic
1141366828 16:83451050-83451072 CCCAGTGATGCTGCTGGTCTGGG + Intronic
1141534906 16:84672593-84672615 GTGGCTGATTCAGCTGGTCTGGG - Intergenic
1141987503 16:87589401-87589423 GGTGCTGATGCTGCTGGTCTGGG - Intergenic
1142033135 16:87848335-87848357 CGTGCTGCTGCTGCTGGGCTGGG + Intronic
1142255829 16:89013476-89013498 GGGGCTGAAGCTGCTGGGCAGGG + Intergenic
1142470623 17:161430-161452 CAGGCAGATGCTGAAGGTCTTGG + Exonic
1142696553 17:1637013-1637035 CAGGATGAAGCTGCAGGTCTGGG - Exonic
1142860069 17:2755866-2755888 CGGGCTGAGGCTGCGGGGCCCGG + Intergenic
1143027947 17:3951970-3951992 GCTGCTGCTGCTGCTGGTCTGGG - Intronic
1143111302 17:4554490-4554512 CAGGCTGATCCTGCAGGCCTGGG + Intronic
1143323310 17:6081842-6081864 GGAGCTGATGCTGCTGGTCAGGG - Intronic
1143877111 17:10000273-10000295 AACGCTGATGCTGCTGGTCTGGG + Intronic
1143942729 17:10559472-10559494 GATACTGATGCTGCTGGTCTGGG - Intergenic
1143970201 17:10789837-10789859 GAGGCTGAGGCTGCTGGTCCAGG + Intergenic
1144088586 17:11833066-11833088 GATGCTGATGCTGCTGGTCCAGG + Intronic
1144099390 17:11930586-11930608 GATGCTGATGCTGCTGGTCCAGG - Intronic
1144194242 17:12875212-12875234 GATGCTGATGCTGCTGGTCCAGG + Intronic
1144273633 17:13643893-13643915 GAGGCTGATGCTGCTGGTCCAGG - Intergenic
1144366203 17:14547267-14547289 GGTACTGATGCTGCTGGTCTAGG + Intergenic
1144394103 17:14826843-14826865 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1144479603 17:15617993-15618015 AGTGCTGATGTTGCTGGACTGGG - Intronic
1144677744 17:17172764-17172786 CGAGTTGACGCTGCTGATCTGGG - Exonic
1144733701 17:17543049-17543071 CCCGGTGGTGCTGCTGGTCTGGG - Intronic
1144918700 17:18745746-18745768 AGTGCTGATGTTGCTGGTCTGGG + Intronic
1144967938 17:19089478-19089500 CTTGCTGAGGCTGCGGGTCTTGG + Intergenic
1144979979 17:19162585-19162607 CTTGCTGAGGCTGCGGGTCTTGG - Intergenic
1144988243 17:19215647-19215669 CTTGCTGAGGCTGCGGGTCTTGG + Intronic
1145093949 17:20009062-20009084 GAGGCTGAAGCTGCTGGTCCGGG + Intergenic
1145252864 17:21305850-21305872 CGGGCTCAGGCTGGTGGCCTTGG + Intronic
1145323711 17:21782066-21782088 CGGGCTCAGGCTGGTGGCCTTGG - Intergenic
1145846586 17:28043180-28043202 GGGGCTGCTGCAGCTGGTCCAGG - Exonic
1146105433 17:30031350-30031372 GATGCTGATGCTGTTGGTCTAGG + Intronic
1146252552 17:31362041-31362063 CCAAATGATGCTGCTGGTCTGGG - Intronic
1146488015 17:33259898-33259920 GATGCTGATGCTGCTGGTCCTGG + Intronic
1146806358 17:35868102-35868124 GATGCTGATGCTGCTGGTCATGG + Intronic
1147547689 17:41415374-41415396 GACACTGATGCTGCTGGTCTGGG + Intergenic
1147879378 17:43644045-43644067 AATGCTGATGCTGCTGATCTGGG - Intronic
1148188245 17:45660184-45660206 GGTGCTGATGCTGCTGGTCTGGG + Intergenic
1148477236 17:47936848-47936870 AGGGCTGATGATACTGGTTTAGG - Intergenic
1149358159 17:55865595-55865617 GTTGATGATGCTGCTGGTCTAGG + Intergenic
1149462089 17:56837061-56837083 GATGCTGATGCTGCTGGTCTAGG - Intronic
1149660606 17:58332389-58332411 GGGGCTTGGGCTGCTGGTCTGGG - Intergenic
1150556194 17:66256769-66256791 GATGGTGATGCTGCTGGTCTGGG - Intergenic
1150893175 17:69178395-69178417 GACGTTGATGCTGCTGGTCTGGG - Intronic
1150998748 17:70349694-70349716 GATGCTGATGCTGCTGGTTTTGG + Intergenic
1151269681 17:72984542-72984564 GTTGCTGATGCTGCTGGCCTTGG - Intronic
1152191456 17:78890715-78890737 AGATCTGCTGCTGCTGGTCTCGG + Exonic
1152198265 17:78930119-78930141 CGGGAGGATGCTGCTCTTCTCGG + Intergenic
1152251715 17:79215994-79216016 AGGGCTGGAGCTGATGGTCTTGG + Intronic
1152256336 17:79242186-79242208 CGTGCTGCTGCTGCTGGTGGAGG + Intronic
1152380318 17:79938966-79938988 CAGGGTGATTCTTCTGGTCTAGG - Exonic
1152381067 17:79942473-79942495 CGGGCTGCTGCTGCTCTCCTGGG + Intronic
1152890592 17:82879533-82879555 CCTTCTGGTGCTGCTGGTCTGGG + Intronic
1152933783 17:83124352-83124374 AGAGCTTATGCTGCTGGGCTGGG + Intergenic
1152941256 17:83173891-83173913 CGGGCTGAGGCAGATGGCCTAGG + Intergenic
1153555594 18:6310080-6310102 GATGCTGATGCTGCTGGTCCAGG + Intronic
1154006310 18:10530510-10530532 AGTGCTGATGGTGCTGGTCCAGG + Intronic
1155958662 18:31975375-31975397 CAGGCTGATGCTGGTGTGCTGGG + Intergenic
1156014327 18:32531068-32531090 GATGCTGATGCTGCTGGTTTGGG - Intergenic
1156324802 18:36064728-36064750 CGGGTTGTTGCTGCTGGTTTGGG - Intronic
1156367182 18:36440168-36440190 GATGCTGATGCTGCTGGTCCAGG + Intronic
1156427867 18:37035271-37035293 GATGCTGATGCTGCTGGACTGGG - Intronic
1156453381 18:37279227-37279249 CAGGCAGGTGCTGCTGGGCTGGG + Intronic
1156734381 18:40235539-40235561 AGGGCTGATGCTGCTTGTTCAGG + Intergenic
1156762691 18:40612583-40612605 CTGCCTGATGCTTCTGTTCTTGG + Intergenic
1157120021 18:44900639-44900661 GATGCTGATGCTGCTGGTCTGGG - Intronic
1157215128 18:45776105-45776127 GATGCTGATGTTGCTGGTCTGGG - Intergenic
1157617578 18:48996308-48996330 AAGGCTGAGGCTGCTGGTCTAGG + Intergenic
1157682496 18:49617962-49617984 CGGCCTGATGGAGGTGGTCTGGG - Intergenic
1157710434 18:49846356-49846378 GATGCTGATGCTGCTGGTCCAGG + Intronic
1157742092 18:50102662-50102684 GGTGCTGCTGCTCCTGGTCTAGG - Intronic
1157921298 18:51715389-51715411 CTGGGTGATGTGGCTGGTCTGGG + Intergenic
1157921498 18:51717674-51717696 GATACTGATGCTGCTGGTCTGGG - Intergenic
1157930208 18:51813387-51813409 GGTGCTGCTGCTACTGGTCTGGG - Intergenic
1158476706 18:57786489-57786511 CATGCTGATGTTGCTGGTCCAGG + Intronic
1158578309 18:58658904-58658926 CTGTCTGATGCTGAAGGTCTTGG + Intergenic
1158688509 18:59638420-59638442 GGTGCTGATGCTGCTGGTCCAGG - Intronic
1158857387 18:61556473-61556495 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1158928913 18:62301679-62301701 GGTGCTAATGCTGCAGGTCTAGG + Intronic
1159085252 18:63782803-63782825 GGTGCTGATGATCCTGGTCTGGG - Intronic
1159244590 18:65789411-65789433 CTGGCTGTTGCTGGTTGTCTTGG - Intronic
1159783008 18:72681064-72681086 GCTGCTGATGTTGCTGGTCTGGG - Intergenic
1160789667 19:917652-917674 GGCGCTGATGCTGCTGGGCCTGG + Exonic
1160792668 19:929724-929746 CGGGCTGCAGCTGCGGGCCTGGG + Exonic
1161556273 19:4944485-4944507 CGGGCTCATCCTGCTTTTCTGGG + Intronic
1161734305 19:5981513-5981535 CATGCTGATGCTGCTGGTGTGGG - Intergenic
1162030004 19:7913249-7913271 TGGGCTGGGGCTGCTGCTCTGGG + Exonic
1164231010 19:23288889-23288911 GGGGCTGATGGTGATGGCCTGGG - Intergenic
1164993306 19:32700139-32700161 CGGGTTGCTGCTGCTGGCTTGGG + Intronic
1165368184 19:35383013-35383035 CTGGTTGTTGCTGCTGGTGTTGG + Intergenic
1165393699 19:35552421-35552443 GATGGTGATGCTGCTGGTCTGGG + Intronic
1165448542 19:35869567-35869589 GGGGCTGGTGCTGGGGGTCTCGG + Intronic
1165788193 19:38474916-38474938 GGGGCTGCTGCTGCTGGGCGGGG + Intronic
1165903933 19:39181927-39181949 CCCAGTGATGCTGCTGGTCTGGG - Intronic
1165989728 19:39803335-39803357 CAAGCTGATGCTGCTGGTCTGGG - Intergenic
1167332342 19:48864030-48864052 GACGCTGATGCTGCTGGTCTGGG + Intronic
1167411786 19:49348483-49348505 TGCGTTGATGCAGCTGGTCTGGG - Intronic
1167998102 19:53423109-53423131 GGGGCTGATGGTGATGGCCTGGG - Intronic
1168007580 19:53503703-53503725 GGGGCTGATGGTGATGGCCTGGG - Intergenic
1168422172 19:56211594-56211616 GGTGCTGATGCTGCTGGTCTTGG + Intergenic
1168423385 19:56219789-56219811 GGTGCTCATGCTGCTGGTCTTGG - Exonic
1168427412 19:56249888-56249910 GATGCTGATGCTGCTGGTCTTGG + Intronic
925203709 2:1989379-1989401 CGGGCTGCAGCTCCTGGGCTGGG - Intronic
925731410 2:6921773-6921795 TGGGGCGATGCTGTTGGTCTGGG + Intronic
925915272 2:8600201-8600223 CGGGCTGCTGATGCTGGGCCTGG - Intergenic
927553841 2:24019219-24019241 GTTGCTGATGCTGCTGGTCCAGG - Intronic
928579551 2:32693322-32693344 GACGCTGATGCTGCTGGTCCAGG - Intronic
928904941 2:36357681-36357703 TGGGCTGATGATGCTGTTCCGGG + Intronic
929066538 2:37981169-37981191 GATGCTGATGCTTCTGGTCTTGG + Intronic
929098490 2:38286421-38286443 GGGCCTGAGGCTGGTGGTCTGGG - Intergenic
929125413 2:38519052-38519074 CATGCTGATGCTGCTGGTCTAGG - Intergenic
929330038 2:40672240-40672262 CGGGTTGCTGCTGCTGGCTTGGG - Intergenic
929484733 2:42343148-42343170 CTGGCTGTGGCTGCTGTTCTGGG - Intronic
929808294 2:45168016-45168038 CTGGCTGATGGTGCAGGTGTGGG - Intergenic
929887129 2:45888927-45888949 CGGGCTGGTTTTGCTGGTCAAGG - Intronic
930804741 2:55479160-55479182 GATGCTGATGCTGCTGGTCCAGG + Intergenic
931386257 2:61800408-61800430 CAGGCTGCTGCAGCTGCTCTAGG + Intergenic
931721725 2:65071862-65071884 GGGGGTGATGCTTCTGGGCTAGG + Exonic
931731144 2:65154472-65154494 GATGCTGATGCTGCTGGTCCAGG - Intergenic
932132341 2:69199281-69199303 GATGCTGATGCTGCTGGTCTGGG + Intronic
932338911 2:70947416-70947438 CTAGGTGATGCTGCTGGTATGGG + Intronic
932416744 2:71578199-71578221 GATGCTGATGCTGCTGGTCCAGG + Intronic
932443104 2:71750471-71750493 GATGCTGATGCTGCTGGTCCAGG + Intergenic
933396046 2:81732608-81732630 TATGCTGATACTGCTGGTCTGGG - Intergenic
933706465 2:85294463-85294485 GATGCTTATGCTGCTGGTCTGGG + Intronic
934164739 2:89283710-89283732 GGGGCTCATTCTCCTGGTCTGGG + Intergenic
934202535 2:89898814-89898836 GGGGCTCATTCTCCTGGTCTGGG - Intergenic
934578924 2:95422721-95422743 AATGCTGATGCTGCTAGTCTGGG + Intergenic
934600523 2:95653982-95654004 AATGCTGATGCTGCTAGTCTGGG - Intergenic
934628273 2:95884004-95884026 GACGCTGATGCTGCTGGTCTTGG - Intronic
934628520 2:95887755-95887777 GACGCTGATGCTGCTGGTCTTGG - Intronic
934631092 2:95923325-95923347 GACGCTGATGCTGCTGGTCTTGG - Intronic
934668595 2:96192231-96192253 GAGTCTGATGCTACTGGTCTGGG - Intronic
934802953 2:97185658-97185680 GATGCTGATGCTGCTGGTCTTGG + Intronic
934805007 2:97213762-97213784 GACGCTGATGCTGCTGGTCTTGG + Intronic
934832229 2:97539863-97539885 GACGCTGATGCTGCTGGTCTTGG - Intronic
934832476 2:97543620-97543642 GACGCTGATGCTGCTGGTCTTGG - Intronic
934833246 2:97554889-97554911 GATGCTGATGCTGCTGGTCTTGG - Intronic
934987511 2:98898603-98898625 CAGGCAGATGCTGTGGGTCTGGG - Intronic
935232171 2:101108609-101108631 TGGCCTGATGTTGCTGGTCTTGG - Intronic
935322362 2:101901581-101901603 GGTGCTGAGGCTGCTGGTTTGGG + Intergenic
935557492 2:104526257-104526279 GATGCTGATGCTGCTGGTCCAGG + Intergenic
935623442 2:105148289-105148311 GGTGCTGCTGCTGCTGGTCTGGG - Intergenic
936131763 2:109849985-109850007 GTTGCTGATGCTTCTGGTCTGGG + Intronic
936212934 2:110521500-110521522 GTTGCTGATGCTTCTGGTCTGGG - Intronic
936652762 2:114448493-114448515 GATGCTGATACTGCTGGTCTAGG - Intronic
936880757 2:117247730-117247752 GGTGCTGATACTGCTGGTCAGGG + Intergenic
936918542 2:117664213-117664235 GATGCTGATGCTGCTGGCCTGGG - Intergenic
936938414 2:117859482-117859504 CCGGGTCCTGCTGCTGGTCTCGG - Intergenic
937324882 2:120984670-120984692 CTGGCTGGTGCTGCTGGCCTCGG - Exonic
937442584 2:121929598-121929620 GAGGCTGATGTTGCTGGTCCCGG - Intergenic
937915581 2:127097276-127097298 AGGGCTGACGCTGCTGGGCCTGG - Intronic
937915606 2:127097368-127097390 AGGGCTGACGCTGCTGGGCCTGG - Intronic
937915619 2:127097414-127097436 AGGGCTGACGCTGCTGGGCCTGG - Intronic
937968582 2:127533348-127533370 AGGGCTGACGCTGCTGCTCCTGG - Intergenic
938061476 2:128258443-128258465 GGGGCTGTGGCAGCTGGTCTTGG + Intronic
938254975 2:129850574-129850596 ATGGCTGATGCTGCTGTGCTAGG - Intergenic
938580170 2:132638515-132638537 GGCGCTGATGCTGCTGTTCCAGG + Intronic
938604425 2:132877571-132877593 GAGGCTGACGCTGCTGGTCCAGG + Intronic
938842880 2:135180088-135180110 GATACTGATGCTGCTGGTCTAGG - Intronic
938904065 2:135822437-135822459 AATGTTGATGCTGCTGGTCTGGG + Intronic
940126062 2:150326261-150326283 GCTGCTGATGCTGCTAGTCTGGG - Intergenic
940170473 2:150824709-150824731 TGTGCTGATGCTACTAGTCTGGG - Intergenic
940514470 2:154663791-154663813 TATGCTGATGCTGCTGGTCTGGG - Intergenic
940635412 2:156292780-156292802 AGGGCTGATGCAGCTTGTATAGG + Intergenic
940969948 2:159884811-159884833 GATGCTGATGCTGTTGGTCTGGG + Intronic
940970538 2:159892060-159892082 AGTGCTGATAATGCTGGTCTGGG - Intronic
941746762 2:169095197-169095219 GATGCTGATGCTGCTGGTCCAGG - Intronic
941906828 2:170724760-170724782 GATGCTGATGCTGCAGGTCTGGG - Intergenic
942231169 2:173862012-173862034 GGTGCTGATGCTGCTGAACTGGG - Intergenic
942364365 2:175208007-175208029 GGTGCTGGTGCTGCTGGTCCAGG + Intergenic
942577056 2:177374804-177374826 AATGCTGATGTTGCTGGTCTGGG + Intronic
942657504 2:178229494-178229516 GATGCTAATGCTGCTGGTCTGGG - Intronic
942719128 2:178929807-178929829 GGTAATGATGCTGCTGGTCTCGG - Intronic
942959160 2:181809169-181809191 GAGGCTGATGCTTCTGGTCTAGG + Intergenic
943056818 2:182992118-182992140 GTTGCTGATGTTGCTGGTCTAGG + Intronic
944353774 2:198760821-198760843 TTTGCTGGTGCTGCTGGTCTGGG - Intergenic
944547438 2:200812016-200812038 CGGGCGGACGCTGCGGGTCGTGG + Intronic
945295996 2:208171996-208172018 CGGGCGTATGCTGCTGCTTTGGG + Exonic
945435824 2:209816630-209816652 GATGCTGATGCTGCTGGTCCAGG + Intronic
945661968 2:212697588-212697610 GATGCTGATACTGCTGGTCTAGG + Intergenic
945802537 2:214451074-214451096 AATACTGATGCTGCTGGTCTGGG - Intronic
946261755 2:218498380-218498402 CACGTTGATGCTGCTGGTCTGGG + Intronic
946398904 2:219458345-219458367 GATGCTGATGCTGCTGGTCTGGG - Intronic
946456465 2:219830631-219830653 GGTGCTGATGCTGCTGCTCAGGG - Intergenic
946736006 2:222755231-222755253 GATGCTGATGCTGCTGCTCTAGG - Intergenic
946792013 2:223310372-223310394 CTGGCTGATGGTGCTGAACTGGG + Intergenic
947315903 2:228857939-228857961 GATGCTGATGCTCCTGGTCTGGG + Intronic
947369717 2:229432642-229432664 GGTGTTGATGCTGCTGGTCTGGG - Intronic
947374994 2:229486807-229486829 AGGGCTGATGCTGCTGATCTGGG - Intronic
947398975 2:229714088-229714110 CGGGAAGAGGCTGCTGGTCCCGG + Intronic
947740313 2:232481855-232481877 GGGCCTGATGCTGCTGCTGTGGG - Intronic
947915818 2:233831035-233831057 CAGGCAGATGCTGGTGGACTGGG + Intronic
947940065 2:234045888-234045910 GGTGCTGAAGCTGCTGGTCTGGG + Intergenic
948029886 2:234808723-234808745 GGTGCTGCTGCTGCTGATCTGGG + Intergenic
948084773 2:235238291-235238313 GGTGCTGATGCTGCTGGTGCAGG - Intergenic
948101072 2:235373664-235373686 CCAGTTGATGCTGCTGGTCCAGG - Intergenic
948137787 2:235649705-235649727 TGTGCTGATGCTGCTTGTCTGGG + Intronic
949041590 2:241852231-241852253 CAGCCTGGTGCTGCTAGTCTGGG - Exonic
1168796048 20:610545-610567 CCGGCAGATGCTGGAGGTCTGGG + Intergenic
1168850202 20:971324-971346 GATGCTGATGCTGCTGGTCCAGG + Intronic
1168995203 20:2128067-2128089 CCAGGTGATGCTGCTGGTCTGGG - Intronic
1169367462 20:5002330-5002352 GATGCTGATGCTACTGGTCTGGG + Intronic
1169475223 20:5924804-5924826 CTGGCTGATGCCACTGGTCAGGG + Intronic
1169604937 20:7306704-7306726 GAGGCTGAGGCTGCTGGTCTGGG + Intergenic
1169714821 20:8603569-8603591 GATGCTGATGTTGCTGGTCTAGG - Intronic
1169879457 20:10330716-10330738 CCAGGTGATGCTGCTGGTTTGGG - Intergenic
1169948793 20:11018991-11019013 CAGGCTGCTGCTTCTGCTCTGGG - Intergenic
1169950935 20:11042435-11042457 GATGCTGATGCTGCTGATCTTGG + Intergenic
1170091676 20:12596082-12596104 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1170238618 20:14136548-14136570 GGTGCTAATGCTGCTGGTCCAGG - Intronic
1170331196 20:15212816-15212838 GCTGCTGATGCTGCTGGCCTAGG - Intronic
1170479592 20:16752848-16752870 CCTGCTGCTGCTGCTGGTCCAGG - Intronic
1170672992 20:18452296-18452318 GATGCTGATGCTGCAGGTCTGGG + Intronic
1170765917 20:19290046-19290068 GGGGCTGCTGCTGCTGGTGGTGG - Intronic
1171047225 20:21821554-21821576 AATGCTGATGCTGCTGGTTTTGG - Intergenic
1171172899 20:23031614-23031636 GAGGCTGATGCTGCCAGTCTGGG + Intergenic
1171173765 20:23036257-23036279 CAGGCTGGTGCTGATGGTCGTGG + Exonic
1171177339 20:23062431-23062453 TGCAGTGATGCTGCTGGTCTGGG - Intergenic
1171178697 20:23075292-23075314 TCTGCTGATGCTGCTGGTCCAGG - Intergenic
1171247774 20:23626525-23626547 GGTGCTGCTGCTGCTGGTCCAGG + Intergenic
1171252150 20:23656516-23656538 GATGCTGATGTTGCTGGTCTGGG + Intergenic
1171377674 20:24704490-24704512 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1172490966 20:35337517-35337539 GATGCTGAGGCTGCTGGTCTGGG + Intronic
1172672938 20:36646748-36646770 CCCGCTGAGGCTGCTGGTCTAGG - Intergenic
1172850367 20:37958094-37958116 AATGCTGATGCTGCTGGTGTTGG + Intergenic
1172884830 20:38223872-38223894 GTTGCTGATGCTGCTGGCCTGGG + Intronic
1173158616 20:40636060-40636082 AATGCTGATGCTGCTGGTCTGGG + Intergenic
1173478620 20:43381929-43381951 GCTGCTGCTGCTGCTGGTCTGGG - Intergenic
1173704392 20:45099215-45099237 GATGCTGATGCTGCTGGTCCGGG - Exonic
1174732203 20:52928840-52928862 CATGCGGATGCTGCTGGTCCAGG - Intergenic
1174845437 20:53938749-53938771 GGTGCTGAGGCTGCTGGTCCTGG + Intronic
1174930533 20:54809100-54809122 GGTGCTGATACTGCTAGTCTGGG - Intergenic
1175902946 20:62367149-62367171 CGGGCTGGCGCTGCTGGGCGCGG - Exonic
1175956301 20:62611275-62611297 CGGGCTGATCCAGCTGGTTCTGG + Intergenic
1176155730 20:63619417-63619439 AGGACTGACGCTGCTGGCCTGGG - Exonic
1176677197 21:9790437-9790459 TGAGGTGATGCTGCTGGCCTGGG - Intergenic
1178298553 21:31431421-31431443 GATGCTGATGTTGCTGGTCTGGG + Intronic
1178454517 21:32735738-32735760 CATGCTGATACTGCTGGTCCAGG + Intronic
1178523893 21:33308731-33308753 GGTGCTGATGCTGCTGGTCTAGG - Intergenic
1179110109 21:38438967-38438989 GGAGGTGATGCTGCTGGTCCCGG + Intronic
1179613040 21:42564763-42564785 CGGCCTGATGCTGCTGCTCGCGG + Exonic
1179644567 21:42767568-42767590 CGGGCTGCACCTGCTGGTTTGGG - Intronic
1180083404 21:45496955-45496977 GGGGCTGGTGCTTCTGGGCTTGG + Intronic
1180180699 21:46117571-46117593 TGGGCTGGGGCTGCTGGGCTGGG - Intronic
1180199314 21:46215180-46215202 CGGGCCGATGCTGATGCTCTTGG + Exonic
1180342304 22:11628635-11628657 CGGGCTCATGAGGCGGGTCTTGG + Intergenic
1181375749 22:22456698-22456720 CAGGCTGATGCTGATGTGCTGGG - Intergenic
1181507147 22:23367072-23367094 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1181750173 22:24983716-24983738 GGGGCTGAAGCTGGGGGTCTGGG + Intronic
1181856786 22:25787407-25787429 AATGCTGATGCTGCTGGTCCAGG + Intronic
1181868136 22:25875557-25875579 GATGCTGATGCTGCTGGTCTGGG - Intronic
1181913166 22:26256683-26256705 GATGCTGATGCTGCTGGTCCAGG - Intronic
1181983138 22:26780613-26780635 GAGGCTGAGGCTGCTGGTCCAGG - Intergenic
1182050116 22:27306213-27306235 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1182098124 22:27639445-27639467 CGGGCTGATGCAGCTGGACGGGG - Intergenic
1182678099 22:32055901-32055923 CTTGCTGATGCTGCTGGTCTGGG - Intronic
1182933044 22:34193135-34193157 GATGCTGATGTTGCTGGTCTGGG + Intergenic
1182946689 22:34330872-34330894 CTGGCTGATGCTGCTGGTCTAGG - Intergenic
1183089668 22:35513007-35513029 GATGCTGATGCAGCTGGTCTGGG + Intergenic
1183093109 22:35536837-35536859 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1184403158 22:44285681-44285703 CGTGTTGATGCTGCTGGTTCTGG - Exonic
1184647832 22:45905816-45905838 CCGGCTCAAGCTGATGGTCTGGG + Intergenic
1184923649 22:47623065-47623087 GGGACTGATGCTGCTGGCCTGGG + Intergenic
1185191267 22:49438040-49438062 CTGGCAGACGCTGCTTGTCTGGG - Intronic
1185231694 22:49687503-49687525 CGGGATGCTGCTGCTGGCCTGGG + Intergenic
949328338 3:2892311-2892333 AATGCTGATGCTGCTTGTCTGGG + Intronic
949533835 3:4980220-4980242 CGGACTGTTGCTGCGGGGCTGGG + Intronic
949613694 3:5730408-5730430 GCAGCTGATGCTACTGGTCTGGG + Intergenic
949744273 3:7270116-7270138 GATGCTGATGCTGCTGATCTGGG + Intronic
949830001 3:8204116-8204138 AATGCTGATGCTGCTGGTCCAGG + Intergenic
949887690 3:8709493-8709515 GATGCTCATGCTGCTGGTCTGGG + Intronic
949934374 3:9105527-9105549 CATGCTCTTGCTGCTGGTCTGGG - Intronic
949961711 3:9317772-9317794 GATGCTGATGCTGCTGGTCCAGG + Intronic
950496108 3:13335522-13335544 CGGGCTGAGGGTGGTGGTCAAGG - Exonic
950884755 3:16353492-16353514 TGAGCTGCTGCTGCTGGTGTGGG - Intronic
950899420 3:16483814-16483836 AATGCTGATGCTGCTGGTCTGGG - Intronic
951040279 3:17982020-17982042 GATGCTGATGCTGCTGGTCTAGG + Intronic
951049868 3:18082296-18082318 GATGCTGATGCTGCTGGTCTAGG - Intronic
951066920 3:18277339-18277361 GAGGCTGATGCTGCTGGTCCAGG + Intronic
951087999 3:18537487-18537509 CAGGCACATGCTGCTGGGCTCGG + Intergenic
951477205 3:23119473-23119495 CCTGCTGCTGCTGCTGTTCTGGG + Intergenic
951590657 3:24261011-24261033 GATGCCGATGCTGCTGGTCTGGG + Intronic
951626997 3:24676479-24676501 TGGGCTGATGCTGATGCTCATGG + Intergenic
951663374 3:25095341-25095363 GGTGCTGATGTTGCTGGTCCAGG - Intergenic
951771180 3:26259305-26259327 GGGAATGATGTTGCTGGTCTAGG - Intergenic
951844618 3:27072270-27072292 GGTGCTGATGCTGCTTGTCTGGG - Intergenic
951995200 3:28719751-28719773 GCTGCTGCTGCTGCTGGTCTGGG + Intergenic
952123096 3:30267772-30267794 GATGCTGATGCTGCTGGTCTAGG + Intergenic
952187349 3:30984381-30984403 GACGCTGATGCTGCTGGTCCAGG + Intergenic
952348303 3:32509470-32509492 GATGATGATGCTGCTGGTCTAGG + Intergenic
952576554 3:34781134-34781156 GATGCTGATGCTGCTGGTCTTGG + Intergenic
952831108 3:37565802-37565824 CCACGTGATGCTGCTGGTCTAGG + Intronic
952912151 3:38200046-38200068 CTGACTGGTGCTGCTGGTGTGGG + Intronic
953137129 3:40190698-40190720 GGTGCTGATGCTGCTGGTCTGGG - Intronic
953308485 3:41853243-41853265 AATGCTCATGCTGCTGGTCTAGG + Intronic
953414049 3:42705491-42705513 CAGGCAGGTGCTGCAGGTCTTGG - Intronic
953626787 3:44578635-44578657 CGAGTTGACGCTGCTGATCTGGG + Intronic
953781243 3:45872645-45872667 AATACTGATGCTGCTGGTCTGGG + Intronic
953831254 3:46299276-46299298 GTGGCTGAGACTGCTGGTCTGGG - Intergenic
954586381 3:51740441-51740463 CAGGCTGATGCTGATGTGCTGGG - Intergenic
955531156 3:59874510-59874532 GATGCTGATGCTGCTGGTCCAGG + Intronic
955661825 3:61307659-61307681 AATGCTGATGCTGCTGGTCTGGG - Intergenic
956362215 3:68460807-68460829 GATGCTGATGCTGCTAGTCTGGG + Intronic
956525029 3:70149428-70149450 GAAGCTGATGCTGCTGGTCTAGG - Intergenic
956716214 3:72082413-72082435 GATGCTGATGCTGCTTGTCTAGG - Intergenic
956998108 3:74851304-74851326 GATGCTTATGCTGCTGGTCTAGG + Intergenic
957031702 3:75249835-75249857 AATGCTGATGCTGTTGGTCTGGG - Intergenic
957337984 3:78857562-78857584 GATGCTGATGCTGCTGGTCTGGG - Intronic
959374456 3:105571260-105571282 GATGCTGATACTGCTGGTCTGGG + Intronic
959778372 3:110199104-110199126 CAAGCAGATGCTGCTGGGCTGGG - Intergenic
960165299 3:114394665-114394687 GATGCTGATGCTACTGGTCTGGG + Intronic
961093570 3:124136378-124136400 GATGCTGATGCTGCTGGTCTGGG + Intronic
961189165 3:124943034-124943056 CATGCTGGTGCTGCTGGTCTGGG - Intronic
961387592 3:126531144-126531166 GAGGCTGCGGCTGCTGGTCTGGG - Intronic
962302306 3:134253187-134253209 GGTGATGATACTGCTGGTCTGGG - Intergenic
962425028 3:135262136-135262158 GCTGCTGATGCTGCTGGTCCAGG + Intergenic
962469773 3:135695915-135695937 AATGCTGATGCTGCTGGTCTGGG - Intergenic
963103529 3:141626277-141626299 AATGCTGATGCTGCTAGTCTTGG - Intergenic
963106598 3:141652808-141652830 GATGCTGAGGCTGCTGGTCTTGG + Intergenic
964663516 3:159147950-159147972 GCTGTTGATGCTGCTGGTCTGGG - Intronic
965403431 3:168241208-168241230 AATGCTGATGCTGCTGGTTTGGG + Intergenic
965607416 3:170510942-170510964 GGGGCTGCTGATGCTGGCCTCGG - Intronic
965641007 3:170829019-170829041 AATGCTGATGCTGCTGGTCCAGG - Intronic
965733525 3:171797395-171797417 AATGCTGATGCTGCTGGTTTGGG - Intronic
965740842 3:171872980-171873002 GATGCCGATGCTGCTGGTCTGGG - Intronic
965867801 3:173226574-173226596 GAAGCTGATGCTGCTGGTCCAGG + Intergenic
966755561 3:183368136-183368158 GATGCTGATGCTGCTGGTCTGGG - Intronic
966825873 3:183964559-183964581 GATGCTGATGCTGCTGATCTGGG + Intronic
967035161 3:185643524-185643546 ATAGCTGATGCTGCTGGTCTGGG + Intergenic
967113197 3:186313572-186313594 GATGCTGATGCTGCTGGTCCAGG - Intronic
967852023 3:194089525-194089547 GAGGCAGATGCTGCTGGTGTGGG - Intergenic
967970836 3:194998393-194998415 GATGCTGATGCTGCTGGTCCTGG - Intergenic
968019017 3:195367270-195367292 GGTGCTGATGCTGCTGGTCCAGG + Intronic
968253482 3:197244812-197244834 CAGGCTGATGCTGATGTGCTGGG + Intronic
968298676 3:197596744-197596766 GCTGGTGATGCTGCTGGTCTGGG + Intergenic
968425696 4:521854-521876 TGGGGTGATGGTGCTGGCCTCGG + Exonic
968547944 4:1208115-1208137 AGGGCTCATGCAGCTGCTCTTGG + Intronic
969087609 4:4668048-4668070 CATGCTGATGTTGCTGGTTTGGG + Intergenic
969110250 4:4839916-4839938 AAGGCTGATGATGCTGGTTTGGG + Intergenic
969156567 4:5216232-5216254 AATGCTGATGCTGCTGGTCTGGG + Intronic
969268219 4:6080067-6080089 CAGGGTGATGCTGCTGAGCTGGG - Intronic
969929305 4:10614559-10614581 TTGGGAGATGCTGCTGGTCTGGG - Intronic
970321335 4:14878490-14878512 GACACTGATGCTGCTGGTCTGGG + Intergenic
970453060 4:16191122-16191144 GGGGCTCATGCTGCTGGTCTGGG - Intronic
970730085 4:19092215-19092237 AGTGCTGATGCTTCTGGCCTAGG + Intergenic
971247807 4:24945946-24945968 GATGCTGATGCTGTTGGTCTGGG + Intronic
971257861 4:25030639-25030661 CGGGCTGCTGCTGCTGCTGCTGG - Exonic
971464475 4:26940944-26940966 AGTGCTGATACTGCTGGTCCAGG + Intronic
972578296 4:40372320-40372342 TGTGCTGATGCTGCTGGTCCGGG - Intergenic
973201279 4:47505337-47505359 AGTACTGATGCTGCTGGTCCTGG - Intronic
973575866 4:52288728-52288750 AATGCTGATGTTGCTGGTCTGGG + Intergenic
974033259 4:56795182-56795204 GCTGCTGATGCTGCTGGTCAGGG - Intergenic
974839218 4:67282381-67282403 CGGGTTGCTGCTGCTGGCTTGGG + Intergenic
975372764 4:73607618-73607640 GGTACAGATGCTGCTGGTCTGGG - Intronic
976088018 4:81425956-81425978 AATGCTGATGCTGCTGGTCCTGG - Intergenic
976476008 4:85483810-85483832 GGAACTGATGCTGCTGGTCCTGG - Intronic
976625761 4:87179982-87180004 AAGGCTGATGCTGCTGGTCGAGG + Intronic
977117759 4:93053171-93053193 CCAGGTGATGCTGCTGCTCTGGG - Intronic
977249582 4:94675050-94675072 GAAGCTGATCCTGCTGGTCTGGG + Intergenic
977957063 4:103040835-103040857 GAGGCTGATGCTGCCAGTCTAGG - Intronic
978492302 4:109322360-109322382 CGGGTTGCTGCTGCTGGCTTGGG - Intergenic
979341503 4:119529906-119529928 GATGCTGATGCTGCTGGTCCAGG - Intronic
979559034 4:122081556-122081578 GATGCTGATGCTGCTGATCTGGG - Intergenic
979753376 4:124307226-124307248 GGGGCTGACACTGCTTGTCTAGG + Intergenic
979947063 4:126845287-126845309 TGGTGTGATACTGCTGGTCTTGG + Intergenic
981440541 4:144777252-144777274 AAGGCTAATGCTGCTGGCCTGGG - Intergenic
981543028 4:145865570-145865592 CATGATGATTCTGCTGGTCTAGG + Intronic
983091499 4:163508359-163508381 GGTGCTGTTGCTGCTGGTTTAGG + Intronic
983539137 4:168889847-168889869 CATGCTAATGCTGCTGGTCCAGG + Intronic
983898573 4:173108021-173108043 GATGCTGATGCTGCTGGCCTGGG - Intergenic
983905506 4:173177228-173177250 GATGCTGATGCTGCTGGTCCAGG + Intronic
984432307 4:179664772-179664794 TGAGCTGCTGCTGCTGCTCTGGG + Intergenic
984663336 4:182397815-182397837 GATGTTGATGCTGCTGGTCTGGG + Intronic
985279447 4:188270811-188270833 GGGGCTGCTGCTGCTGGTGCTGG - Intergenic
985398347 4:189568343-189568365 TGAGGTGATGCTGCTGGCCTGGG + Intergenic
985610338 5:884478-884500 TGGTCTGGTGCTGCTGGGCTGGG + Intronic
985904279 5:2821139-2821161 GGGGGTGATTCTGCTGGTCCAGG - Intergenic
986771347 5:10976922-10976944 GATGCTGATGCTGCTGGTCTTGG - Intronic
987093687 5:14529659-14529681 GAGGCCGATGCTGCTGGTCCAGG - Intronic
988459731 5:31423402-31423424 GATGCAGATGCTGCTGGTCTGGG + Intronic
988625126 5:32866697-32866719 GATGCTGATGCTGCTGGTCCAGG + Intergenic
988679457 5:33470766-33470788 CAGGCTGATTCTGTAGGTCTGGG + Intergenic
988706880 5:33735313-33735335 GATGCTGATGCTGCTGGTCCGGG + Intronic
989246893 5:39265000-39265022 GAGGCTGACGCTGCTGGTCCAGG - Intronic
989475284 5:41867976-41867998 GATGTTGATGCTGCTGGTCTGGG - Intronic
989496736 5:42117478-42117500 CGGGTTGCTGCTGCTGGCTTGGG - Intergenic
989617115 5:43348291-43348313 GGGGCTGATGCTGCTGGGAGTGG - Intergenic
990356763 5:54975419-54975441 GGTGCAGATGCTGCTGGTCTAGG - Intergenic
991399049 5:66234723-66234745 CATGCTGATGCTGCTGGTTCTGG + Intergenic
991405129 5:66293963-66293985 CATGCTGATGCTGCTGGTTCTGG - Intergenic
991921753 5:71664195-71664217 GACACTGATGCTGCTGGTCTGGG + Intergenic
992714628 5:79497864-79497886 CATGCTGATGCTGCTGGTCCAGG - Intronic
993486712 5:88495972-88495994 GCTGCTGATGCTGCCGGTCTGGG + Intergenic
994188991 5:96846636-96846658 CATGCTGTTGCTGCTGGTCTGGG + Intronic
994323865 5:98426158-98426180 GCTGCTGCTGCTGCTGGTCTTGG - Intergenic
995385996 5:111589621-111589643 GATGCTGATGCTGCTGGTCTGGG - Intergenic
996072369 5:119147876-119147898 GACGCTGATGCTGCTGGCCTGGG - Intronic
996172020 5:120305164-120305186 GATGCTGATGCTGCTGGTCTGGG + Intergenic
996588546 5:125119319-125119341 GATGCTGATGCTGCTGGTCTCGG - Intergenic
997082874 5:130761561-130761583 GTTGCTGATGCTGCTGGTCCAGG - Intergenic
997257790 5:132442596-132442618 GATGCTGATGCTGCTGGTCTGGG + Intronic
997362871 5:133306203-133306225 CCGGGTGGGGCTGCTGGTCTTGG + Intronic
997840849 5:137237860-137237882 GTTGCAGATGCTGCTGGTCTGGG + Intronic
998308494 5:141102563-141102585 CAGGCTGGTGGTGCTGGTCAAGG + Exonic
998311558 5:141137345-141137367 CAGGCTGGTGGTGCTGGTCAAGG + Exonic
998313534 5:141157914-141157936 CAGGCTGGTGGTGCTGGTCAAGG + Intergenic
998318008 5:141201688-141201710 CAGGCTGGTGGTGCTGGTCAAGG + Exonic
998318967 5:141210821-141210843 CAGGCTGGTGGTGCTGGTCAAGG + Exonic
998319532 5:141216037-141216059 CAGGCTGGTGGTGCTGGTCAAGG + Exonic
998320509 5:141225419-141225441 CAGGCTGGTGGTGCTGGTCAAGG + Exonic
998321522 5:141236468-141236490 CAGGCTGGTGGTGCTGGTCAAGG + Intergenic
998322081 5:141241824-141241846 CAGGCTGATGGTCCTGGTCAAGG + Intergenic
998946786 5:147348499-147348521 GATGCTGATGCTGCTGATCTGGG + Intronic
999041765 5:148421295-148421317 GGAGCTGATACTGCTGGTCTGGG + Intronic
999094608 5:148966789-148966811 GAGCCTGATGCTGGTGGTCTCGG - Intronic
999142720 5:149373119-149373141 GATGCTGGTGCTGCTGGTCTGGG - Intronic
999177256 5:149640133-149640155 AGGGCAGAAGCTGCTGGTCTTGG + Intergenic
999418402 5:151419709-151419731 GGTGCTGATGCAGCTGGACTGGG + Intergenic
999626677 5:153528581-153528603 GATGCTGATGCTGCTGGTCCAGG + Intronic
1001003625 5:168030550-168030572 GATGCTGATTCTGCTGGTCTGGG + Intronic
1002927155 6:1611224-1611246 CAGGCTGCTGCTGCTGCTGTCGG - Exonic
1003123050 6:3333737-3333759 GAGGCTGCTGCTGCAGGTCTGGG - Intronic
1003500255 6:6697240-6697262 GGTGCTGATGCTGCTGGTCTGGG - Intergenic
1003774078 6:9339842-9339864 CCAGATGATGCTGCTGGTCTGGG + Intergenic
1004170429 6:13291656-13291678 CCTGCTGATGCTGCTGGTCCAGG + Intronic
1004228884 6:13813877-13813899 CGGGCAGATGCCGGTGGCCTTGG + Intronic
1004429803 6:15533210-15533232 GGGGCTGGGGCTGCTGGTGTGGG - Intronic
1004518900 6:16344036-16344058 GCTGCTGATGCTGCTGGTCCAGG + Intronic
1004526152 6:16409893-16409915 TGGGCTGATGATGCTGGTTGCGG + Intronic
1004879338 6:19991402-19991424 GACACTGATGCTGCTGGTCTGGG + Intergenic
1004894274 6:20131823-20131845 CATGCTGATGGTGCTGGTCCAGG - Intronic
1005148560 6:22721343-22721365 TATGCTGATGCTGCTGGTTTGGG + Intergenic
1005174727 6:23031705-23031727 CGGGATGCTGCTGCTGGGCCAGG + Intergenic
1005348070 6:24909874-24909896 CGGGCTGATTCTGCTGGGATGGG - Intronic
1006305257 6:33214774-33214796 GATGCTGATGCTGCTAGTCTGGG - Intergenic
1006759708 6:36449125-36449147 CGGGCTGCTGCTGCTGGCTCAGG + Intronic
1006796760 6:36737118-36737140 TGGGCTCATGCTGCTGGTGGTGG + Intergenic
1006806971 6:36794852-36794874 CATGCTGGTGCTGCTGGTCTGGG - Intronic
1007034262 6:38658515-38658537 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1007240141 6:40418953-40418975 GATGCTGATGCTGCTGGTCTTGG - Intronic
1008487259 6:52049885-52049907 GATGCTGATTCTGCTGGTCTGGG - Intronic
1008496407 6:52138457-52138479 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1008617887 6:53243698-53243720 GGTGCTGAGGCTGCTGGTCTGGG + Intergenic
1008670296 6:53761427-53761449 GATGCTGATGCTGCTGGTCTTGG + Intergenic
1008806355 6:55433646-55433668 GGGGATTATCCTGCTGGTCTTGG + Intergenic
1009360999 6:62814291-62814313 CGGGCTGATGCTCCTATTTTAGG - Intergenic
1009923863 6:70096787-70096809 AATGCTGATGCTGCTGGTCTGGG - Intronic
1011026194 6:82872137-82872159 GATGCTGATGTTGCTGGTCTGGG - Intergenic
1011714322 6:90088626-90088648 GAGGCTGATGCAGCTGGTCCAGG - Intronic
1011825683 6:91302867-91302889 CGGGTTGATGCTGCTGGTTTGGG + Intergenic
1012771812 6:103447334-103447356 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1012988297 6:105898463-105898485 GATGCTGATGCTGCTGATCTGGG + Intergenic
1013309920 6:108884264-108884286 GATGCTGATGCTGCTGGTCCAGG - Intronic
1013481715 6:110558548-110558570 GGGGGTGATGGTGGTGGTCTTGG + Intergenic
1013742697 6:113306555-113306577 GGTGCTGATGCTGCTAATCTGGG + Intergenic
1014015333 6:116523072-116523094 GATACTGATGCTGCTGGTCTAGG + Exonic
1014209721 6:118695569-118695591 GATGCTGATGTTGCTGGTCTTGG + Intronic
1014558021 6:122856586-122856608 GATGCTGATGTTGCTGGTCTGGG + Intergenic
1015029460 6:128576810-128576832 GATGCTGATGCTGCTGGCCTGGG - Intergenic
1015299230 6:131633755-131633777 CAGGCTAATGCTGCTGTTTTAGG + Intronic
1015344784 6:132143485-132143507 AGTGCTGCTGCTGCTGTTCTAGG - Intergenic
1016884928 6:148950267-148950289 GATGCTGATGCTGCAGGTCTGGG + Intronic
1017275984 6:152569094-152569116 GGTGCTGATGCTGCTGCTCTGGG - Intronic
1017649740 6:156570043-156570065 GGGTCCAATGCTGCTGGTCTAGG + Intergenic
1017703135 6:157095191-157095213 TCTGCTGAAGCTGCTGGTCTGGG + Intronic
1017718503 6:157228694-157228716 CGGGCAGTTGGTGCTGGGCTGGG - Intergenic
1017795126 6:157836921-157836943 GATGCTGATGCTGCTGGTCTAGG + Intronic
1018422583 6:163652383-163652405 GGGGCTGCTGCTGCTGGTGGTGG - Intergenic
1018482666 6:164207392-164207414 TGGGCTGAAGCTGCTGGCCCAGG + Intergenic
1018913788 6:168120567-168120589 GGTGCTGTTGCTGCTGGCCTGGG - Intergenic
1019096855 6:169588720-169588742 CAGGCTGCTGCTGCTGGTCCAGG + Intronic
1019617769 7:1973966-1973988 CACGCTGATGCTGCTGGGCGGGG + Intronic
1019649284 7:2147863-2147885 GGGCCTGCTGCTGCTGGTCAAGG + Intronic
1020582155 7:10016577-10016599 GCTGTTGATGCTGCTGGTCTTGG + Intergenic
1020771687 7:12403665-12403687 CGCGCTGATGTTCCTGGCCTGGG - Exonic
1021164001 7:17311384-17311406 GATGCTGATCCTGCTGGTCTAGG + Intronic
1021614158 7:22485900-22485922 GATGCTGATGCTGCTGGTTTGGG + Intronic
1021903396 7:25310085-25310107 GGTGCTGATGCTGCTGGTTCAGG - Intergenic
1021930636 7:25577864-25577886 CCAGGTGATGCTGCTGGTCTAGG + Intergenic
1021952525 7:25789375-25789397 GATGCTGATGCTGCTGGCCTGGG - Intergenic
1022128498 7:27380467-27380489 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1022212043 7:28220696-28220718 GAGGCGGATGCTGCTGGTCCAGG - Intergenic
1022242597 7:28527472-28527494 GATGCTGATGCTGCTGGTCTGGG + Intronic
1022429619 7:30303716-30303738 GATGCTGATGCTGCTGGTCTGGG - Intronic
1022457432 7:30570598-30570620 CGGGTTGATGCTGCTGGCTGTGG - Intergenic
1022463347 7:30633191-30633213 GATACTGATGCTGCTGGTCTAGG - Intronic
1022560714 7:31346284-31346306 CGTGCTGTTTCTTCTGGTCTGGG + Intergenic
1023044842 7:36201963-36201985 GATGCTGATGCTGCTGGTCCAGG - Intronic
1023576048 7:41628080-41628102 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1023727478 7:43159026-43159048 GGTGCTGGAGCTGCTGGTCTAGG + Intronic
1023852562 7:44158522-44158544 TGGGCAGATGCTGCAGGCCTGGG + Intronic
1024299735 7:47877740-47877762 TAGTCCGATGCTGCTGGTCTGGG - Intronic
1024672847 7:51612466-51612488 GATGTTGATGCTGCTGGTCTGGG - Intergenic
1025233169 7:57216534-57216556 GGAGCTGGTGCTGCTGTTCTAGG + Intergenic
1026282845 7:68937032-68937054 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1026402364 7:70027491-70027513 GATGCTGCTGCTGCTGGTCTGGG - Intronic
1026539010 7:71264012-71264034 CTAGGTGATACTGCTGGTCTTGG + Intronic
1026566230 7:71491782-71491804 GGTGCTGATGCTGCTGGCCTGGG + Intronic
1026896316 7:74012043-74012065 GCAGCTGGTGCTGCTGGTCTTGG - Intergenic
1027002195 7:74661217-74661239 CAGGCTGATTCTGCAGGTCTGGG + Intronic
1028125776 7:87111457-87111479 GATGCTGATGCTGCTGGTGTGGG - Intergenic
1028144081 7:87302744-87302766 AATGCTGATGCTGCAGGTCTGGG - Intergenic
1028243190 7:88446006-88446028 GATACTGATGCTGCTGGTCTGGG - Intergenic
1028342321 7:89736526-89736548 CATGCTGATGCTGCTTGTCAAGG + Intergenic
1029033969 7:97499161-97499183 GTTGTTGATGCTGCTGGTCTGGG + Intergenic
1029483101 7:100824614-100824636 CGAGCAGAGGCTGCTGGTGTGGG + Intronic
1030110544 7:106023069-106023091 GGTGCTGATTCTGATGGTCTAGG - Intronic
1030111746 7:106032581-106032603 TGGGCTGAGGATGCTGGTCTGGG + Exonic
1030261678 7:107571615-107571637 AATACTGATGCTGCTGGTCTGGG - Intronic
1030655047 7:112158181-112158203 TGTGCTGATGCTTCTGGTCTTGG + Intronic
1031041368 7:116841772-116841794 GGTGCTGATGCTGCTTGTCAGGG - Intronic
1031126426 7:117778513-117778535 GATACTGATGCTGCTGGTCTGGG - Intronic
1031432180 7:121685243-121685265 CAGGCTGATGCTGGTGGTCAAGG - Intergenic
1031977810 7:128104851-128104873 GATGCTGATGCTGCTGTTCTGGG - Intergenic
1032609438 7:133396060-133396082 GATGCTGATGCTGCTGGTCTGGG - Intronic
1032677134 7:134141389-134141411 GAGGCTGATGCTGCTGGTCCGGG + Intronic
1033171079 7:139085070-139085092 AGTGCTGATGGTGCTGGTCCGGG - Intronic
1033257713 7:139816581-139816603 GATGCTGATGCTGCTGGTCTGGG - Intronic
1033301757 7:140192441-140192463 TGTGCTGATGCCACTGGTCTGGG + Intergenic
1034909479 7:154982682-154982704 GGGGCAGATGCTGCTGATCCAGG + Intronic
1036568912 8:9962425-9962447 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1036698325 8:10993865-10993887 TGGGCTGAGGCTGCAGGTATAGG - Intronic
1036905979 8:12708742-12708764 GGGGCAGATGCTGCTTGTCGAGG + Intergenic
1037188993 8:16099578-16099600 CAGGCTGATGCTGGTGTGCTAGG - Intergenic
1038815714 8:30902002-30902024 TGTGCTGATGCTGCTGATCTAGG - Intergenic
1038887759 8:31684086-31684108 GGTATTGATGCTGCTGGTCTGGG - Intronic
1039078739 8:33715500-33715522 GATGCTGATGCTGGTGGTCTGGG + Intergenic
1039371954 8:36994027-36994049 GATGGTGATGCTGCTGGTCTGGG + Intergenic
1039844856 8:41318789-41318811 GATGCTGATGCTGCTGGTCTGGG - Intergenic
1041203165 8:55471387-55471409 CGTGCTGATGCTGCTGGTTGAGG - Intronic
1041790624 8:61692810-61692832 TGATCTGATGTTGCTGGTCTAGG + Intronic
1042274677 8:66991919-66991941 TCTGCTGCTGCTGCTGGTCTAGG + Intronic
1042404546 8:68388858-68388880 CATGCTGATGCTGCTGGTCCAGG + Intronic
1043504460 8:80888566-80888588 AGGGTTGGTGTTGCTGGTCTGGG - Intergenic
1043822916 8:84890654-84890676 TATACTGATGCTGCTGGTCTGGG + Intronic
1044107564 8:88230224-88230246 GATGCAGATGCTGCTGGTCTAGG + Intronic
1044199619 8:89418349-89418371 GATGTTGATGCTGCTGGTCTGGG + Intergenic
1044407126 8:91840409-91840431 GATGCTGATGCTGCTGGACTGGG + Intergenic
1045183433 8:99811532-99811554 GCTGCTGATGCTGCTGGTCCAGG + Intronic
1045377792 8:101592527-101592549 AGAGCTGATGTGGCTGGTCTGGG - Intronic
1045403970 8:101846818-101846840 TCAGCTGATGCAGCTGGTCTGGG + Intronic
1045642579 8:104268314-104268336 GGTGCTAATGCTGCTGATCTGGG + Intergenic
1046154280 8:110266922-110266944 GATGCTGATGATGCTGGTCTAGG - Intergenic
1046329728 8:112699095-112699117 CGGGTTGCTGCTGCTGGCTTGGG - Intronic
1047064738 8:121268376-121268398 GATGCTGATGCTGCTTGTCTGGG - Intergenic
1047343993 8:124009710-124009732 GGAGCTGGTGCTGCTGTTCTAGG + Intronic
1047516309 8:125557392-125557414 CAGGATGATGCTGATGTTCTGGG + Intergenic
1047570039 8:126087803-126087825 AATGCTGATGCTGCTGGTCTGGG - Intergenic
1047807263 8:128373456-128373478 GGTGCTGCTGCTGCTGGTGTAGG + Intergenic
1048329650 8:133463204-133463226 CCGGGTGATGCTGCTGGCCCGGG + Intronic
1048455365 8:134573446-134573468 CAGGCTGATGTTGCTGGTGGAGG + Intronic
1048524551 8:135190332-135190354 TGGGCTGAAGCTGCTGTGCTGGG - Intergenic
1049149430 8:141024910-141024932 TGGACTGATGCTGATGGTCCAGG + Intergenic
1049708577 8:144053770-144053792 TGGTCTGAGGCTGCAGGTCTGGG - Intronic
1049737977 8:144220150-144220172 TGAGCTAATGCTGCTGGTCTGGG - Intronic
1049952548 9:659470-659492 AATGCTGATGCTGCTGTTCTGGG + Intronic
1050003006 9:1098572-1098594 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1050054633 9:1639093-1639115 AGAGCTGATGCTGCTGGTCCTGG - Intergenic
1050064358 9:1743304-1743326 AGGGCAGCTGCTGCTGGGCTGGG - Intergenic
1050109158 9:2196898-2196920 CATGCTGATGCTGCTAGTTTGGG - Intergenic
1050247265 9:3703731-3703753 GGTGCTGATGCTGCTGGTCCAGG - Intergenic
1050280036 9:4040880-4040902 AGTGCTGATGCTGCTGGACCAGG - Intronic
1050702739 9:8359210-8359232 GCTGCTGATGCTGCTGGTCATGG - Intronic
1051125579 9:13800865-13800887 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1052024453 9:23559070-23559092 GATGCTGATGCTGCTAGTCTAGG + Intergenic
1052086548 9:24273725-24273747 GATACTGATGCTGCTGGTCTGGG + Intergenic
1052349405 9:27443145-27443167 GATCCTGATGCTGCTGGTCTAGG + Intronic
1052999189 9:34568179-34568201 CGGGCTGATGTTGCTGTTTGAGG + Intronic
1053257702 9:36632197-36632219 GATGCTGATGCTGCAGGTCTTGG + Intronic
1053598906 9:39590659-39590681 GGTGCTCATGCTGCTGGTCTGGG + Intergenic
1053856660 9:42345176-42345198 GGTGCTCATGCTGCTGGTCTGGG + Intergenic
1054776760 9:69130541-69130563 CATGCTGCTGCTGCTGCTCTGGG + Intronic
1054870894 9:70046236-70046258 GATGCTGATGATGCTGGTCTCGG + Intronic
1055023756 9:71697186-71697208 GATCCTGATGCTGCTGGTCTGGG + Intronic
1055219633 9:73913095-73913117 AATGCTGATGTTGCTGGTCTGGG - Intergenic
1055257110 9:74384600-74384622 AGTGCTAATGCTTCTGGTCTAGG - Intergenic
1055296316 9:74837349-74837371 GATGCTGATGCTGCTGGTCCAGG + Intronic
1055355715 9:75435182-75435204 CTAGGTGATGCTGCTGGTCTGGG + Intergenic
1055604389 9:77953164-77953186 TAAGCTGCTGCTGCTGGTCTGGG + Intronic
1055715532 9:79113589-79113611 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1055753015 9:79528089-79528111 TAGGCTGATGCTGCTGGCCCAGG + Intergenic
1055818285 9:80232504-80232526 GCAGCTGAGGCTGCTGGTCTAGG + Intergenic
1055868197 9:80841320-80841342 GATGCTGATGCTGCTGGTCCTGG - Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056464490 9:86840258-86840280 AATGCTGATGCTGCTGTTCTGGG + Intergenic
1056493267 9:87129210-87129232 AGGGCTGGTGCTGCTGATCTGGG - Intergenic
1056545736 9:87611824-87611846 GATGCGGATGCTGCTGGTCTGGG + Intronic
1056742097 9:89266274-89266296 CCAGGTGATGCTGCTGCTCTGGG + Intergenic
1056823260 9:89859462-89859484 GATGCTGATGTTGCTGGTCTAGG + Intergenic
1056825443 9:89873534-89873556 TGTCCTGATGCTGCAGGTCTGGG + Intergenic
1056928635 9:90855852-90855874 GATGCTGATGCTGCTGGTCTGGG + Intronic
1057201417 9:93142368-93142390 GGGGCTGATGCTGCTGGCCCAGG + Intergenic
1057846886 9:98532738-98532760 CCTGCTGATGATGCTGGTCCAGG + Intronic
1057966271 9:99506355-99506377 TGTGCTAATGCTACTGGTCTTGG - Intergenic
1057985617 9:99710718-99710740 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1058000176 9:99856837-99856859 GATGCTGATGCTGCTGGTCTGGG + Intronic
1058531548 9:105910562-105910584 CATGCTGATGATGGTGGTCTCGG + Intergenic
1058623657 9:106911571-106911593 GATGCTGATGCTGCTGGTCCAGG + Intronic
1058867759 9:109177246-109177268 AATGCTGATGCTGCTAGTCTGGG - Intronic
1059952969 9:119486994-119487016 GATGCTGCTGCTGCTGGTCTGGG - Intergenic
1060036311 9:120258966-120258988 CTGTCTGATGCCCCTGGTCTTGG - Intergenic
1060237580 9:121876760-121876782 GGCACTGATGCTGCTGGGCTGGG - Intronic
1060970574 9:127735204-127735226 CGGGCTGCTCGGGCTGGTCTCGG - Exonic
1061039696 9:128132821-128132843 GATGCTGATGCTGCTGGTCTAGG - Intergenic
1061178514 9:129011011-129011033 CTGGCTCAGGCTGCTGGGCTGGG + Intronic
1061909775 9:133716491-133716513 GGGGCTGAGGCTGCTGGCCTGGG - Intronic
1061909797 9:133716548-133716570 GGGGCTGAGGCTGCTGGCCTGGG - Intronic
1186196386 X:7113779-7113801 CATACTGATGCTGCTGGTCCGGG - Intronic
1186470828 X:9821036-9821058 GATACTGATGCTGCTGGTCTGGG - Intronic
1186563006 X:10632677-10632699 AGGGCCGATGCTGTTGGTTTTGG + Intronic
1186763522 X:12747683-12747705 GAGGCTGATGCTGCTGGCCCAGG + Intergenic
1186764932 X:12761072-12761094 GATGCTGATGCTGCTGGTCCAGG + Intergenic
1186974501 X:14886699-14886721 ACTGCTGATGCTGCTGGTCAGGG - Intronic
1186996405 X:15128226-15128248 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1187067985 X:15859514-15859536 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1187105647 X:16238790-16238812 GATGCTGATGCTGCTGATCTGGG + Intergenic
1187117870 X:16371774-16371796 GATGCTGATACTGCTGGTCTGGG + Intergenic
1187246291 X:17555506-17555528 GGGGCTGATGCTGCTGGTCTGGG + Intronic
1187345776 X:18462352-18462374 GATGCTGATGCTGCTGGTCTGGG - Intronic
1187508584 X:19897457-19897479 CATGCTGCTGCTGCTGGGCTGGG - Intergenic
1187510535 X:19913642-19913664 GATGCTGATGTTGCTGGTCTGGG + Exonic
1187528597 X:20076138-20076160 GATGCTGATGCTGCTAGTCTAGG + Intronic
1187629460 X:21152848-21152870 GATGCTGATGCTGCTGCTCTTGG + Intergenic
1187707577 X:22023533-22023555 GATGCTGATGCTGCTAGTCTGGG - Intergenic
1187719989 X:22140087-22140109 AATTCTGATGCTGCTGGTCTGGG + Intronic
1188022655 X:25175547-25175569 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1188138013 X:26513309-26513331 CATGCTGATGCGGCTGGTCTAGG + Intergenic
1188350677 X:29127375-29127397 GATGCTGATGCTGCTGGTCCAGG + Intronic
1188354694 X:29176405-29176427 GATGTTGATGCTGCTGGTCTAGG + Intronic
1188398297 X:29713503-29713525 CCAGGTGATGCTTCTGGTCTAGG - Intronic
1188538721 X:31225752-31225774 GATGCTGATGCTGCTGGTCCAGG + Intronic
1188650106 X:32621823-32621845 TGGGCTGATGCTGTTGGTCCAGG - Intronic
1189124035 X:38426442-38426464 GATGCTGATGCTGCTGGTCCAGG + Intronic
1189171752 X:38916242-38916264 GATGCTGATGCTGCTGGTCTGGG + Intergenic
1189211932 X:39290987-39291009 GCTGCTGATGCTGCTGGTCGAGG + Intergenic
1189250721 X:39599058-39599080 GATGTTGATGCTGCTGGTCTGGG + Intergenic
1189403119 X:40690934-40690956 TGGGCTGATGATGATGGCCTTGG - Intronic
1189560814 X:42189725-42189747 CATGCTGATGCTGCTGGTTCGGG - Intergenic
1189741392 X:44120588-44120610 GATGCTGAGGCTGCTGGTCTAGG - Intergenic
1189862893 X:45291593-45291615 GATGCTGATGCTGCTGGTCCAGG - Intergenic
1189943913 X:46157403-46157425 GATGCTGATGCTGCTGGTCCGGG - Intergenic
1190367315 X:49708499-49708521 GATGCTGAGGCTGCTGGTCTGGG + Intergenic
1190399344 X:50016071-50016093 GATGCTGATGCTGCTAGTCTTGG - Intronic
1190827604 X:54031956-54031978 GATGCTGATGCTGCTGGTCCAGG + Intronic
1190827648 X:54032291-54032313 AATGCTGATCCTGCTGGTCTGGG + Intronic
1191634133 X:63358107-63358129 TGGGCTGATGCTGCAGCTTTAGG - Intergenic
1191668853 X:63730620-63730642 GATACTGATGCTGCTGGTCTGGG + Intronic
1192175742 X:68884168-68884190 GGTGTTGAAGCTGCTGGTCTGGG - Intergenic
1193801421 X:85941272-85941294 GTTGCTCATGCTGCTGGTCTAGG - Intronic
1194872076 X:99144811-99144833 GATGCTGATGCTGCTGATCTAGG + Intergenic
1195404872 X:104501835-104501857 GAGGCTGATGCTACTGGTCCAGG - Intergenic
1195418051 X:104641710-104641732 TGGGCTGCAGCTGCCGGTCTTGG - Intronic
1195652484 X:107299843-107299865 TGAGCTGAAGCTGCTGGTCCGGG - Intergenic
1195821782 X:108953518-108953540 GGTGCTGATGCTGCTGGTAAAGG - Intergenic
1196963944 X:121035093-121035115 AATGCTGATGCTGCTGGCCTAGG - Intergenic
1197328882 X:125128852-125128874 TGTGCTGATGCTGTTGGTGTTGG + Intergenic
1197440952 X:126489426-126489448 TATTCTGATGCTGCTGGTCTGGG - Intergenic
1198228018 X:134664266-134664288 AATGCTGATGCTGTTGGTCTGGG + Intronic
1198562068 X:137861147-137861169 GATGCTGATGCTGCTGGTCGGGG + Intergenic
1198651159 X:138865079-138865101 GGTGCTGATGCTGCTGGTCAAGG + Intronic
1198950854 X:142070521-142070543 GATGCTGACGCTGCTGGTCTGGG - Intergenic
1199082123 X:143588759-143588781 CGGGTTGCTGCTGCTGGCGTGGG + Intergenic
1199766362 X:150944492-150944514 GATGCTGATGCTGCTGGTCCGGG + Intergenic
1200272553 X:154699419-154699441 CAGGCTGGTGCCTCTGGTCTTGG - Exonic
1201242852 Y:11975413-11975435 CGGGCTGCTGATCCTGGTTTTGG + Intergenic