ID: 1063355577

View in Genome Browser
Species Human (GRCh38)
Location 10:5395470-5395492
Sequence TCCCATCTGCAGAGGGTGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 267}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063355567_1063355577 29 Left 1063355567 10:5395418-5395440 CCGCTAAGGAGCTGCTCGGGGTG 0: 1
1: 0
2: 1
3: 6
4: 96
Right 1063355577 10:5395470-5395492 TCCCATCTGCAGAGGGTGAAAGG 0: 1
1: 0
2: 2
3: 37
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063355577 Original CRISPR TCCCATCTGCAGAGGGTGAA AGG Exonic
900001834 1:18748-18770 TGGCCTCTGCAGAGGGGGAACGG + Intergenic
900021554 1:189271-189293 TGGCCTCTGCAGAGGGGGAACGG + Intergenic
901021734 1:6259563-6259585 TCCCATCTGCAGTGTGGGGACGG - Intronic
902187120 1:14733853-14733875 TCCCATCTGGAGAGGCTGATCGG - Intronic
902242930 1:15100787-15100809 TCCCATCTGCAGAGCGAGGACGG + Intronic
902812293 1:18895322-18895344 TCCCACTTGTAGAGGGTGAGGGG - Intronic
902892048 1:19451602-19451624 TCCCATCTGCAGGGTGGGGATGG - Intronic
903404777 1:23087196-23087218 CCCAATCTGCAAAGTGTGAAGGG - Exonic
903547708 1:24137034-24137056 TCCCCTCTGGAGTGGGTGGAGGG - Intronic
904294203 1:29507209-29507231 CACCACCTGCAGAGGGTGAGGGG - Intergenic
904834181 1:33324346-33324368 CTCCACCTGCAGAGGGTGTAGGG + Exonic
904903644 1:33877594-33877616 TCCCTTTTGCAGACTGTGAAAGG + Intronic
904916710 1:33975686-33975708 TCCCCTCTGTAGCAGGTGAAGGG + Intronic
905309028 1:37036879-37036901 TCCCAGCTGCAGAGGCTGTGGGG + Intergenic
905339924 1:37271539-37271561 TCCCATTTGCTGATGGTCAAGGG - Intergenic
906476861 1:46175251-46175273 TCCTAACTGCACAGGGAGAAGGG - Exonic
906965038 1:50448117-50448139 TCCCTTCTCCACTGGGTGAAAGG + Intronic
910011716 1:82471871-82471893 TCCCCTCCGCAGAGGTTGGAAGG + Intergenic
912013471 1:105002198-105002220 TTCCATCTGCAGTGTATGAAAGG + Intergenic
912346840 1:108971459-108971481 TTCTATCTGCAGAGGATGACAGG + Exonic
913225247 1:116693351-116693373 TCCCCACCTCAGAGGGTGAAGGG - Intergenic
915271963 1:154759761-154759783 TCCCAGCAGAAGAGAGTGAAGGG + Intronic
916569026 1:166008855-166008877 TCCCACCTGCTGAGGAGGAATGG + Intergenic
918310854 1:183284168-183284190 TGCCACCTGAGGAGGGTGAATGG + Intronic
919385043 1:196911035-196911057 TTCCATGTACAGAGGATGAATGG + Intronic
920398221 1:205661488-205661510 TCCCGTCTGCTGAGGCTGAATGG + Intronic
920444540 1:206005922-206005944 TCCCATGTGCAAAGGCTGTAAGG - Intergenic
921076037 1:211700932-211700954 TCCCATTCCCAGAGGCTGAAGGG - Intergenic
922995352 1:229953457-229953479 TCCCCTCCCCAGAGGGGGAATGG - Intergenic
923163345 1:231337132-231337154 GCCCAACTGCAGCGGGTGCACGG - Exonic
923526658 1:234778176-234778198 TCCCTTCAGCAGAGGGCAAAGGG + Intergenic
924117975 1:240766494-240766516 TCCCATTTGGAGAGAGTGGAGGG + Intergenic
1063355577 10:5395470-5395492 TCCCATCTGCAGAGGGTGAAAGG + Exonic
1065221832 10:23503774-23503796 TCCAATCTGCTGAGTGTGAATGG + Intergenic
1067033253 10:42894752-42894774 TCCCATCTTCAGTGGGAGAAAGG - Intergenic
1067069848 10:43123654-43123676 GACCATCTGCAGAGAGTGAAAGG - Exonic
1068673970 10:59750955-59750977 TCCCATTTGGAGTTGGTGAATGG + Intergenic
1068805335 10:61188766-61188788 TCCAGTCTGCAGGGGGAGAAGGG - Intergenic
1069741926 10:70690372-70690394 TCTCCTCTGCAAAGGGTGGAAGG - Intronic
1070306213 10:75240665-75240687 CCTCATCTGGAGAGGCTGAATGG + Intergenic
1072581743 10:96745741-96745763 TCCCACCTGGAGAGTGTGAAGGG - Intergenic
1074060468 10:109960874-109960896 TCCCAGCTGCCCAGGGAGAAGGG + Intergenic
1074698470 10:116072249-116072271 TCCCAACTGGAGAGAGTGAGGGG + Intronic
1074881587 10:117663573-117663595 CCCCATCTGGAAAAGGTGAATGG + Intergenic
1075732090 10:124642482-124642504 TCCCATCTGCAGAAGCTGCCCGG + Intronic
1076236674 10:128868857-128868879 TCCCATCTACAGAGCAGGAAGGG + Intergenic
1076269228 10:129136314-129136336 CCCCCTCTGCAGAGGAAGAAAGG - Intergenic
1076435398 10:130437864-130437886 TGCCCCTTGCAGAGGGTGAATGG + Intergenic
1076633933 10:131870517-131870539 TCCCAGCAGGTGAGGGTGAAGGG - Intergenic
1076672517 10:132131108-132131130 TCCCAGCTGCAGAGGATGCCTGG - Intronic
1076704265 10:132292834-132292856 TGCCATCTCCAGAGGGTGAGAGG - Intronic
1077425441 11:2473861-2473883 TCCCATCTGTGGAGGGCGAGTGG - Intronic
1077914546 11:6602793-6602815 TCACATCTGCAGAGGCTCAAAGG + Intronic
1078258624 11:9683279-9683301 TCCCAGCTGCTGGGGGTGAGGGG + Intronic
1078312155 11:10255048-10255070 TCACAGAAGCAGAGGGTGAATGG + Intronic
1079073777 11:17370576-17370598 TCCCAACACCTGAGGGTGAAGGG - Intronic
1080640280 11:34154621-34154643 TTCCCTCTGAAGGGGGTGAATGG + Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1081575652 11:44317203-44317225 ACCGATCTGCAAAGGGTGGACGG - Intergenic
1082715171 11:56603367-56603389 TCCTATCTCAGGAGGGTGAATGG - Intergenic
1083783612 11:64931419-64931441 TGCCAGCTGCAGGGGGTGACAGG - Exonic
1084444462 11:69195722-69195744 TCCCATCTGGAAAGTGTGATGGG + Intergenic
1084735287 11:71101539-71101561 CTCCATCTGCAGAGGGTGAGAGG - Intronic
1086449091 11:86898704-86898726 CTCCATCAGCAGAGGGTGATGGG + Intronic
1087333163 11:96809560-96809582 TCCCATTTGATCAGGGTGAATGG + Intergenic
1088423799 11:109678109-109678131 TCCCTTGTGCAAAGGGTGAAAGG - Intergenic
1089721266 11:120425158-120425180 TCCCATCTGCACAGGGAGAAGGG + Intronic
1089970054 11:122686058-122686080 TTCCATGAGCAGAGGGAGAAGGG - Intronic
1090003533 11:122981444-122981466 TCCCTTATGCAGAGGGTGATGGG + Exonic
1091374914 12:18853-18875 TCGCCTCTGCAGAGGGGGAATGG + Intergenic
1091464627 12:673252-673274 TCCCATCTTCACAGGGAGAAAGG - Intergenic
1092143908 12:6201544-6201566 TCCCATTTGTAGAGGCTGAGTGG - Intronic
1092569250 12:9704556-9704578 ACCAAACAGCAGAGGGTGAAAGG - Intergenic
1096765763 12:53887860-53887882 TCCCAAGTGCAGAAGGGGAAAGG - Intergenic
1097981424 12:65741378-65741400 GCCCAGCTGCGGAGGGGGAAAGG + Intergenic
1099801332 12:87460447-87460469 TCAAATCTTCAGAGGGTGAAAGG - Intergenic
1102328974 12:112013327-112013349 TCCCATCTGTCTAGGGTGAGAGG - Exonic
1103560085 12:121789036-121789058 GCCCATCTGCAGAGGCTGGATGG - Intronic
1104220922 12:126784506-126784528 ACCCACCAGCAGAGGGCGAAAGG + Intergenic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1105827190 13:24133231-24133253 TCCTCTCTGCACAGGTTGAAGGG + Intronic
1106143767 13:27034142-27034164 CCCCATCAGCAGGGGCTGAATGG + Intergenic
1107412031 13:40166752-40166774 TCCCACCTGAAGAGGGAGAAGGG - Intergenic
1107631952 13:42351423-42351445 CCCCCTATGCAGAGGGAGAAGGG - Intergenic
1109993775 13:70094830-70094852 TCCTATCTGGAGAGGATGAGAGG - Intronic
1112394939 13:99020828-99020850 TCCATTCTGCAGTGGCTGAAAGG + Intronic
1113799335 13:113078306-113078328 TCCCCTCTCCAGAGGGTCAGAGG + Intronic
1114633952 14:24177127-24177149 TCCTCTCTGGACAGGGTGAACGG + Exonic
1117123033 14:52589464-52589486 TATCATCTGAAGAGGGTGGATGG + Intronic
1121185438 14:91963580-91963602 TCCCACCCCCAGATGGTGAAGGG - Intergenic
1121338183 14:93089784-93089806 TCCCAGCTGCAGAGCCTGACAGG - Intronic
1121903584 14:97718606-97718628 GCCCATCAGCAGAGAGGGAAAGG - Intergenic
1122295724 14:100704691-100704713 TGCCATCAGAAGAGGGTGACTGG - Intergenic
1124067131 15:26354830-26354852 TGCCATCTCCAGAGGCTGAGTGG - Intergenic
1124438701 15:29671807-29671829 TCCCAGCTTCAGAGGCTGAGAGG + Intergenic
1125502485 15:40248270-40248292 TCCCATCAGCAGAGAGAGATGGG + Intronic
1127866987 15:63041510-63041532 TCCCATCTCCCAAGGGGGAAAGG - Intergenic
1127890542 15:63246744-63246766 TCCCTTCTCCAGAGGTCGAATGG + Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128086700 15:64891685-64891707 TCCCATCTGCAATGGGAGAGGGG - Intronic
1128602576 15:69010269-69010291 TCCCCTCTGTGGAGGGTGCATGG + Intronic
1130081394 15:80737034-80737056 TCCCATATGCTGAGTGGGAATGG + Intronic
1130152959 15:81324980-81325002 TCGCATCTTCACAGCGTGAATGG + Intergenic
1130395177 15:83495050-83495072 TTCCACCTGCAGAGGGTGTATGG + Intronic
1130678709 15:85977723-85977745 TTCCATCTGCTGAAGATGAACGG + Intergenic
1130922064 15:88355856-88355878 GACCATCTGCAGAGGGTTTAGGG + Intergenic
1131953020 15:97702144-97702166 TGCCATCAGCAGAGACTGAAGGG + Intergenic
1132451675 15:101972192-101972214 TGGCCTCTGCAGAGGGGGAACGG - Intergenic
1132455216 16:18437-18459 TGACCTCTGCAGAGGGGGAACGG + Intronic
1133097033 16:3454342-3454364 ACCCATGGCCAGAGGGTGAAAGG + Intronic
1135177218 16:20240882-20240904 TCCCAATTGCAGAGGAGGAAAGG - Intergenic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1137455927 16:48617879-48617901 TCCTAGCTGTAGAGGGTGATGGG - Intronic
1137617525 16:49856328-49856350 ACCCATCTGAGGAGGGGGAACGG + Intronic
1139307207 16:65997086-65997108 TGACCTTTGCAGAGGGTGAATGG + Intergenic
1141300146 16:82807485-82807507 TCCCAACTGGAGTGGGTGAGTGG + Intronic
1141441907 16:84034513-84034535 TCCCATCTCCAGTGGTTGCAGGG - Intronic
1141887389 16:86901899-86901921 ACCCACCTGCAGAGGGGGATGGG - Intergenic
1142933477 17:3308322-3308344 TCCCCTCTGCAGAGGCTGCTGGG + Intergenic
1145799344 17:27673117-27673139 GTCCATCTGCCAAGGGTGAAGGG + Intergenic
1146844712 17:36175351-36175373 TTCCACCTGCCAAGGGTGAAGGG + Intronic
1146857018 17:36263286-36263308 TTCCACCTGCCAAGGGTGAAGGG + Intronic
1146863599 17:36325089-36325111 TTCCACCTGCCAAGGGTGAAGGG - Intronic
1146872928 17:36387196-36387218 TTCCACCTGCCAAGGGTGAAGGG + Intronic
1146880286 17:36438282-36438304 TTCCACCTGCCAAGGGTGAAGGG + Intronic
1147066459 17:37925677-37925699 TTCCACCTGCCAAGGGTGAAGGG - Intronic
1147075812 17:37987821-37987843 TTCCACCTGCCAAGGGTGAAGGG + Intronic
1147077991 17:38005238-38005260 TTCCACCTGCCAAGGGTGAAGGG - Intronic
1147087337 17:38067367-38067389 TTCCACCTGCCAAGGGTGAAGGG + Intronic
1147093927 17:38129173-38129195 TTCCACCTGCCAAGGGTGAAGGG - Intergenic
1147103281 17:38191330-38191352 TTCCACCTGCCAAGGGTGAAGGG + Intergenic
1147937880 17:44024051-44024073 AACCAGCTGCAGCGGGTGAAGGG - Intergenic
1147986060 17:44308495-44308517 ACCAATCCGCAGAGGGTGCAGGG - Intronic
1148756750 17:49977109-49977131 TCCCAGGGGCAGAAGGTGAATGG - Intergenic
1149847856 17:60017799-60017821 TTCCACCTGCCAAGGGTGAAGGG + Intergenic
1150086212 17:62274416-62274438 TTCCACCTGCCAAGGGTGAAGGG + Intronic
1151362664 17:73597984-73598006 TCCCATCTGTAGAAGTAGAAAGG - Intronic
1151819447 17:76489796-76489818 TCCATTCTGTAGATGGTGAATGG + Intronic
1151962814 17:77416214-77416236 TCCCAGCTGGAGAGGGTCAAGGG + Intronic
1152335546 17:79698571-79698593 GCCAATGTGCAGAGGGTGACAGG + Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152785682 17:82246755-82246777 TCCCATCTCCACAGGGCGCAAGG + Intronic
1153070892 18:1103089-1103111 TTCCAGCTGCAGAGGCTGGAGGG + Intergenic
1155170823 18:23265763-23265785 TCCCCACTGGAGAGGGTGGATGG + Intronic
1155631442 18:27898203-27898225 TCCCATCTTCACAGTGTGCAAGG + Intergenic
1156634625 18:39012336-39012358 TCCCATCTTCAAAAGGAGAAGGG - Intergenic
1157335544 18:46734553-46734575 TCTCCTCTGCAGAGGCTCAAAGG - Intronic
1158011229 18:52730224-52730246 TCACAACTGGAGAGGGAGAAGGG + Intronic
1158868508 18:61661284-61661306 GTAGATCTGCAGAGGGTGAAGGG - Intergenic
1160633586 19:60356-60378 TGGCCTCTGCAGAGGGGGAACGG + Intergenic
1163860540 19:19740573-19740595 GTCCATCTGCTGAGGGTGAGGGG - Intergenic
1165229795 19:34379734-34379756 TCAAAGCTGCAGAGGTTGAATGG - Intronic
1167523181 19:49969163-49969185 TCCCAGCTCCACAGGGAGAAGGG - Intergenic
1167660345 19:50792452-50792474 TCCCATCTGCACAGTGGGGATGG + Intronic
1168451214 19:56467978-56468000 TCCCCTCCCCAGAGGTTGAAGGG + Intronic
925059054 2:876880-876902 TCCGAGCTGCAGAGAGTGAAAGG - Intergenic
925275737 2:2646953-2646975 TCCCACCTGCAGGTGCTGAAAGG - Intergenic
925838026 2:7964796-7964818 TCCCATCTACTGAGGATGAATGG + Intergenic
925943891 2:8843088-8843110 TCAGATCTGCAGTGGGGGAAGGG - Intergenic
928108940 2:28490869-28490891 TCCCATCTGGAGAGGCTGCCAGG + Intronic
928404280 2:31002728-31002750 TCCCACCTGCAGAGAATGGATGG + Intronic
929587488 2:43125623-43125645 GCCCATCAGCAGAGGGAAAAAGG + Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
931720733 2:65066035-65066057 TCCCAGCAGCTGAGGGTGTAAGG + Intronic
932717113 2:74109147-74109169 ATCCATCTGCAGAGCCTGAAGGG + Intergenic
933037058 2:77413088-77413110 TCCCATGTGCAGTTGGTTAATGG + Intronic
933567763 2:83971789-83971811 ATCCATCTGCAGAGTGTGCAGGG + Intergenic
933688192 2:85159623-85159645 TCCCATCTCCAGTAGGTCAAAGG - Intronic
934545137 2:95207864-95207886 TGCCCGCTGCAGAGGGAGAAAGG + Intronic
935347314 2:102120759-102120781 ACCCACCTGCAGAGCGTGGAGGG - Intronic
936567886 2:113594659-113594681 TGGCCTCTGCAGAGGGGGAACGG - Intergenic
937458505 2:122065407-122065429 TCCCATTTGCACAAGTTGAAAGG + Intergenic
939853559 2:147329656-147329678 TTCCTTCTTCAGAGAGTGAATGG - Intergenic
940083426 2:149830778-149830800 TCCTATCTGTAGAGGATCAAGGG - Intergenic
940899906 2:159117104-159117126 TCCTCTATGCTGAGGGTGAAAGG + Intronic
941549807 2:166901033-166901055 TCCCATCAGCAAAGGCTGAGTGG - Intronic
943477093 2:188370144-188370166 TCGTATCTTCAGAGGGGGAAAGG + Intronic
946033726 2:216725277-216725299 TCCAACCTGCAGAGGGTGGAGGG + Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948318099 2:237045743-237045765 TCCCTTCTGGGGATGGTGAAAGG - Intergenic
948798811 2:240420807-240420829 TCCCATCTGCAGAGGGCGTGGGG - Intergenic
1169166903 20:3431900-3431922 TCCCATTTTCAGAGGGTGTCTGG + Intergenic
1170193036 20:13662585-13662607 TACCCTGTGCAGAGGGAGAAGGG - Intergenic
1170847660 20:19975508-19975530 TCCCAGCTGCAGAAGGTGAGCGG + Exonic
1172033065 20:31995281-31995303 TCCCAGGCGCAGAGGGTGAAGGG - Intronic
1172181721 20:33007837-33007859 ACCCTTCTGCAGAGGGTGGCTGG - Intronic
1172998421 20:39088320-39088342 TTCCAGCTGCAGAGGGAGAAGGG - Intergenic
1173580493 20:44143447-44143469 CCCAAGCGGCAGAGGGTGAAGGG - Intronic
1174242654 20:49150262-49150284 TCCCATTTCCAGATGATGAAAGG - Intronic
1174351189 20:49969470-49969492 TCACATAAGCAGAGGTTGAAGGG + Intergenic
1174883444 20:54305720-54305742 TCCCATGTGCTGAGGGGGAAAGG + Intergenic
1175583882 20:60122050-60122072 TCACATCTGCTGGGGGAGAACGG - Intergenic
1176416165 21:6476011-6476033 ACCCATCTGCACACGGTGACGGG + Intergenic
1177922494 21:27169757-27169779 TGCCATCAACAGATGGTGAAGGG - Intergenic
1179575188 21:42303687-42303709 TCCCACCTGGAGGGTGTGAATGG + Intergenic
1179691665 21:43084345-43084367 ACCCATCTGCACACGGTGACGGG + Intergenic
1180145350 21:45915630-45915652 TCCCTACTGCAGCAGGTGAAGGG + Intronic
1180600086 22:17009798-17009820 TGCCATCAGCAGAGGGTCTATGG - Intergenic
1180983872 22:19892680-19892702 TCCCTTATGCTGTGGGTGAACGG + Intronic
1182008799 22:26983317-26983339 TGCCATCTCCAGAGGGTGGCTGG - Intergenic
1183424200 22:37729823-37729845 TTCCATATTCAGAGGATGAATGG - Intronic
1183988869 22:41584753-41584775 ACCAAGCTGCAGAGGGAGAAAGG - Intronic
1184357618 22:43993035-43993057 TCCCAACTGCAGAGGGAATAAGG - Intronic
1184911604 22:47539009-47539031 TGCCATCTGCAGAGAGGGAAAGG - Intergenic
1184934031 22:47705836-47705858 TCCCATCAGCAGTGCGTGAGGGG + Intergenic
1184964750 22:47963113-47963135 TTTCATCTGCAGAGGGGTAAGGG + Intergenic
1185034849 22:48468397-48468419 CTGCCTCTGCAGAGGGTGAATGG + Intergenic
1185277581 22:49956507-49956529 TCCTATCTGCAGCGGGTGAGAGG + Intergenic
950820603 3:15754298-15754320 TCCCATAAGGAAAGGGTGAATGG - Intronic
950934677 3:16826278-16826300 TCCCATCTAAAGAGAGTGGATGG - Intronic
952258473 3:31715827-31715849 TCTCATCTGCGGATGGTAAATGG + Intronic
952523157 3:34182851-34182873 TCACATCTCCAGAGTGAGAAAGG + Intergenic
954647935 3:52142913-52142935 TCCCGTCAGCAGAGGATGAGAGG + Intronic
957770117 3:84679688-84679710 TACCATCATCAGAAGGTGAAAGG - Intergenic
958019483 3:87979338-87979360 TCCCAACACCAGAGGGTGATGGG + Intergenic
958153680 3:89725436-89725458 CCCCATCAGCAGAGGCTGAGTGG + Intergenic
961482601 3:127193569-127193591 TCGCAGCTGCAGCGGGTGGAGGG - Intronic
962070456 3:132028492-132028514 ACCCTTCTGCTGAGGGGGAAGGG + Intronic
963249760 3:143092276-143092298 TGGCAGCTGCAGAGGGAGAAAGG + Intergenic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968869714 4:3235548-3235570 ACACATCTGCACAGGGAGAAAGG - Exonic
968982337 4:3857035-3857057 TCTCAGCTGGAGAGGGTCAAAGG - Intergenic
972628087 4:40820262-40820284 TCCCATCTGCAGAAGGTAACTGG + Intronic
973179630 4:47251915-47251937 TCCCAACTGCAGAGGGAAAAAGG + Intronic
973314783 4:48748582-48748604 TCCCATCTGTAGCTGGGGAAAGG - Intronic
976284913 4:83362053-83362075 GCCCATTTGCAGAGAGAGAAAGG + Intergenic
977308157 4:95351231-95351253 TGGCATGTTCAGAGGGTGAAGGG + Intronic
981073208 4:140567010-140567032 TCCCATCTGCCAAGGGATAATGG + Intronic
981542321 4:145858867-145858889 TTCCATGTCCAGAGGGTCAAAGG + Intronic
984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG + Intronic
984720306 4:182966043-182966065 TAGCATCTGTAGAGGGAGAATGG - Intergenic
986007725 5:3682007-3682029 TCCCATTTGGAGGGGGTGGAGGG + Intergenic
986643150 5:9891695-9891717 TTCCATCTGCAGAGAATGAGAGG - Intergenic
987140536 5:14941131-14941153 TCCACTCTGCAGAGTTTGAATGG - Intergenic
987204244 5:15608917-15608939 ACCCATTTACAGAAGGTGAAAGG + Intronic
990338949 5:54803266-54803288 TCCCATATGCAGAGGCATAACGG - Intergenic
991323336 5:65401447-65401469 TCCCAGCAGCAGAAGGGGAAAGG - Intronic
998357883 5:141556537-141556559 TGCCACCTTCAGAGGGAGAAAGG - Intronic
999744247 5:154579577-154579599 TACCAACTGCAGAGGAAGAAAGG + Intergenic
1000408077 5:160909803-160909825 TCACAACTGCAGAGAGTGCAGGG + Intergenic
1001795878 5:174502064-174502086 TCCCATAAGCAGAAGGTGGAGGG + Intergenic
1005087894 6:22025610-22025632 TCCCAAGTGCAGGGGGTGGAGGG - Intergenic
1006154559 6:32007252-32007274 GCTCTCCTGCAGAGGGTGAAAGG - Intergenic
1006160870 6:32039988-32040010 GCTCTCCTGCAGAGGGTGAAAGG - Exonic
1006301208 6:33194309-33194331 TCCCATCTGAAGAGTGGAAATGG - Exonic
1006636926 6:35467903-35467925 TCCCCTCTGCAGGCGTTGAAAGG + Intergenic
1008448854 6:51625749-51625771 TGCCATCTGCAGAGAGTGGCAGG - Intronic
1009665895 6:66679093-66679115 TCCCATCTGCAAAGGCTCACAGG + Intergenic
1011360098 6:86514614-86514636 TCTCTTTTGCAGAGGGTGACAGG + Intergenic
1016597947 6:145822513-145822535 TCCAATATGCAAAGGGTTAAAGG + Intergenic
1019281452 7:202468-202490 TCCCATGTGCATAGAGAGAATGG + Intronic
1019680406 7:2344957-2344979 TCCTATCTGCTGTGCGTGAAAGG - Intronic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1020121623 7:5507310-5507332 TCCTGTCTGGAGAGGGTGAAAGG - Intronic
1022531058 7:31067166-31067188 TCCCACCTGGACAGGGTTAAAGG - Intronic
1022552681 7:31256366-31256388 GCAAACCTGCAGAGGGTGAAGGG - Intergenic
1024115545 7:46189615-46189637 TCCTATCAGAAGAAGGTGAAGGG + Intergenic
1024292193 7:47812734-47812756 TCCCATGTCCTGAGGGTGAGGGG - Intronic
1024626773 7:51214389-51214411 TCCCATCTGGACAGGGTAACTGG - Intronic
1024828983 7:53425998-53426020 TCCAATCTGCAGTGGCTGAGAGG + Intergenic
1028457149 7:91050792-91050814 TCCAATCAGGAGAAGGTGAAGGG + Intronic
1029714832 7:102320168-102320190 CCCCATCTGGAGATGGGGAATGG - Intronic
1032991619 7:137400669-137400691 TGTCAGCTGCAGAGGATGAAAGG - Intronic
1033216207 7:139495456-139495478 TCACATCTGCACTGGGTGAATGG + Intergenic
1034963889 7:155379617-155379639 TCACATATGCAGAGTCTGAAAGG + Intergenic
1036588108 8:10143727-10143749 TCCCATGGGCACAGGGTGATTGG - Intronic
1036674559 8:10819132-10819154 TTCCATCTGCTGAGGGTGCAGGG + Intronic
1037405270 8:18536033-18536055 ACCCACCTGGAGAGTGTGAATGG + Intronic
1037689520 8:21170546-21170568 TCCCCTCTGCAGGATGTGAACGG + Intergenic
1039473069 8:37826043-37826065 TCCCATCTGCAGAGCATCAGTGG + Intronic
1041043324 8:53868189-53868211 TCCTATTTGCTGAGGGTGAGAGG + Intronic
1041344388 8:56881418-56881440 TTGCTTCAGCAGAGGGTGAATGG + Intergenic
1044087866 8:87963239-87963261 TCCCATCTGCATATGGTGGCAGG - Intergenic
1045804401 8:106140428-106140450 GTCCATGTGCAGAGGGTGAGAGG + Intergenic
1046503884 8:115112061-115112083 TGCCAGCTGCAGTGGGGGAAGGG - Intergenic
1047301927 8:123620935-123620957 TCCCATCTGTAGAATGGGAATGG + Intergenic
1049208131 8:141372823-141372845 TCCCATCTTCAGAAGAGGAAAGG + Intergenic
1049783718 8:144440578-144440600 TCCCAGCTGCCGAGGGTGGATGG + Intronic
1049884642 9:18861-18883 TGGCCTCTGCAGAGGGGGAACGG + Intergenic
1054932764 9:70653277-70653299 TACCATCTGCTGAAGGTGAGAGG + Intronic
1055738442 9:79359193-79359215 TCGCATCTATATAGGGTGAAGGG - Intergenic
1057620020 9:96626534-96626556 CATCATCTGCAAAGGGTGAAGGG - Intergenic
1057891986 9:98876437-98876459 CCCCATCTGCAAAGGGTCCAGGG - Intergenic
1058489030 9:105475341-105475363 TCACAGCTGAAGAGGGAGAATGG + Intronic
1059357093 9:113708359-113708381 TCCCATATGCTGAGGGAAAAAGG - Intergenic
1059419883 9:114184242-114184264 ACCCAGCTGCAGAGGTTGAATGG + Intronic
1059680116 9:116577720-116577742 TCCCTTCTCCACAGGGTCAAAGG - Intronic
1059694344 9:116716497-116716519 TCCCATCTGTAGAATGGGAATGG + Intronic
1060023053 9:120148895-120148917 TGGCATCTGCAGAGGCTGAGAGG + Intergenic
1060731588 9:126040259-126040281 TCCCATTTACAGACGGGGAAAGG + Intergenic
1062053335 9:134458333-134458355 GCCCACCTGCAGAGTGGGAAGGG - Intergenic
1062549396 9:137078959-137078981 TGCCGTCTGCAGACGGAGAAGGG - Exonic
1203790437 EBV:148704-148726 TCTCATCCCCAGAGGGCGAATGG - Intergenic
1186409372 X:9332912-9332934 ACCCATCTTCAGAGGGTACAGGG - Intergenic
1187197911 X:17105754-17105776 TCCCACTTACAGTGGGTGAAAGG - Intronic
1187449574 X:19384707-19384729 TCCCATCTGCCCAGGCTGGAGGG - Intronic
1188882701 X:35509645-35509667 TCTCATCTACTGAAGGTGAAAGG + Intergenic
1190194026 X:48301657-48301679 TCCCATCTGTGGAGGGACAAAGG + Intergenic
1192189562 X:68982685-68982707 TCCCAGCTGCAGAAGATGAAGGG + Intergenic
1192220904 X:69196741-69196763 TGCCATCTGCTGAGGGGGTAGGG + Intergenic
1192484262 X:71511498-71511520 TCCCATCTTCAAGGAGTGAAAGG + Intronic
1193650361 X:84123594-84123616 TCCCCTCTCCACAGGGAGAAGGG - Intronic
1193975090 X:88108582-88108604 CCCCATCTGCAGAGTCTAAATGG - Intergenic
1196010345 X:110880295-110880317 ATCCATCTGCAGATGGTGACAGG + Intergenic
1200401163 X:156021291-156021313 TGACCTCTGCAGAGGGGGAACGG - Intergenic