ID: 1063357208

View in Genome Browser
Species Human (GRCh38)
Location 10:5412606-5412628
Sequence TCTGCCTGGCAGAGGCTGGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 0, 2: 7, 3: 60, 4: 434}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063357203_1063357208 -7 Left 1063357203 10:5412590-5412612 CCGCTGACAGGCGCTTTCTGCCT 0: 1
1: 0
2: 1
3: 10
4: 157
Right 1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG 0: 1
1: 0
2: 7
3: 60
4: 434
1063357200_1063357208 21 Left 1063357200 10:5412562-5412584 CCCGGATGACGGCGGTGGCGGCT 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG 0: 1
1: 0
2: 7
3: 60
4: 434
1063357201_1063357208 20 Left 1063357201 10:5412563-5412585 CCGGATGACGGCGGTGGCGGCTG 0: 1
1: 0
2: 0
3: 14
4: 112
Right 1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG 0: 1
1: 0
2: 7
3: 60
4: 434
1063357199_1063357208 22 Left 1063357199 10:5412561-5412583 CCCCGGATGACGGCGGTGGCGGC 0: 1
1: 0
2: 1
3: 41
4: 122
Right 1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG 0: 1
1: 0
2: 7
3: 60
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063357208 Original CRISPR TCTGCCTGGCAGAGGCTGGC GGG Exonic
900238377 1:1603234-1603256 TTTGCCTGGCAGGGGAAGGCTGG + Intergenic
900289081 1:1916232-1916254 GCTGCCTGGCAGAGCCCTGCTGG + Intronic
900291267 1:1924547-1924569 GCAGCCAGGCAGGGGCTGGCGGG - Intronic
900793199 1:4692699-4692721 TCTGCTTGGCTGAGCCTGGAAGG - Intronic
900881676 1:5386202-5386224 TCTACCTGGCACAGGCTGGTGGG + Intergenic
901787763 1:11635992-11636014 TCTGGGTCTCAGAGGCTGGCAGG + Intergenic
902211943 1:14910755-14910777 TCTGCCTGGCCACGACTGGCAGG - Intronic
902445204 1:16458850-16458872 TGTGCCTGGCTGGGTCTGGCTGG - Exonic
902696406 1:18143604-18143626 ATGGCCTGGCAGAGCCTGGCTGG + Intronic
902735515 1:18398212-18398234 TCTGCGTGTCTTAGGCTGGCGGG + Intergenic
902785584 1:18730798-18730820 TCTGCTGGGGAGAGGCTTGCTGG - Intronic
902838683 1:19062055-19062077 TGTGGCTGGGAGAGGCTGGGAGG - Intergenic
903326977 1:22574479-22574501 GCTGGCTGCCAGGGGCTGGCAGG - Intronic
903350345 1:22712998-22713020 TCGCCCTGGCAGAGGCTGGTTGG + Intronic
903414175 1:23170082-23170104 TCTGGCTGGGAGAAGCTGGGAGG - Intronic
903861507 1:26367544-26367566 TGCGCCTGGCAGAGGCTGGAGGG - Intronic
905450350 1:38052061-38052083 TTTGACTGGAAGAGTCTGGCAGG + Intergenic
907813777 1:57898249-57898271 TCTGCCAGACAGAGGCTGACTGG + Intronic
908829944 1:68168768-68168790 TATGTCTGCCAGAGGCTGGGAGG - Intronic
909595835 1:77405480-77405502 TCAACCTTGAAGAGGCTGGCTGG - Intronic
912491255 1:110064008-110064030 GCTGGCTGGGAAAGGCTGGCTGG - Intronic
912491259 1:110064022-110064044 CCTGGCTGGGAAAGGCTGGCTGG - Intronic
912812548 1:112804894-112804916 TCTGCCTGGCAGAAGCCGACCGG + Intergenic
914248218 1:145901385-145901407 TCTGGTTGGCAGAGTCTGTCAGG - Intronic
915588345 1:156857295-156857317 TCTGCCTCGCAGAGCCTGATTGG - Intronic
915839542 1:159203386-159203408 AATGCCTGGCAGAGGGTGGGGGG - Intronic
916585638 1:166147471-166147493 TCTGCCTGGAGAAGGCTGGATGG + Intronic
916824364 1:168429953-168429975 TCTGAGGGGCAGAGGCTGCCTGG + Intergenic
918595514 1:186288354-186288376 TATACCTGGTAGAGGCAGGCAGG - Intergenic
919741075 1:200982070-200982092 TGGGCCTGGCAGAGTCTGGGGGG - Intronic
922752468 1:228077018-228077040 GCTTCCAGGCAGAGGCTAGCAGG - Intergenic
924719956 1:246613353-246613375 TTTGTCTTGCTGAGGCTGGCAGG - Intronic
1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG + Exonic
1064030467 10:11879875-11879897 TGTGCCTGGCTGGGGCTGGCTGG - Intergenic
1064149202 10:12848961-12848983 TGGGACTGGCAGAGGCCGGCCGG - Intergenic
1065624461 10:27616298-27616320 TGTACCTGGCAGAGCCTGGCTGG - Intergenic
1066191062 10:33056670-33056692 TATGCCTGGCAGATGCTGATGGG + Intergenic
1066203561 10:33165014-33165036 TCAGCCAGCCAGAGGCTGTCAGG + Intergenic
1067662676 10:48248064-48248086 TCTGCCTTTCAGAGCCTGGAGGG + Intronic
1069291087 10:66780426-66780448 GATGACTGGCAGATGCTGGCAGG + Intronic
1069526947 10:69180601-69180623 TCTGCTGGGCCGAGGCTGGTTGG + Intronic
1069846753 10:71377431-71377453 TTTGCCTGCCAGAGGCCAGCGGG - Intergenic
1069942594 10:71965345-71965367 GCAGCGTGGAAGAGGCTGGCAGG + Intronic
1069956300 10:72053949-72053971 GCTGCCTGGCAGAGTCAGGGAGG + Intergenic
1071486831 10:86107778-86107800 TCTGCTGGTCAGTGGCTGGCTGG - Intronic
1073319230 10:102604194-102604216 TCAGCCCTGCAGAGTCTGGCTGG - Intronic
1073454864 10:103630283-103630305 GCTTCCTGGCAGAGGCTGCTGGG - Intronic
1073616768 10:105004242-105004264 GCTCCCAGGCAGAGCCTGGCTGG - Intronic
1074151377 10:110762688-110762710 TGTGGCTGGCTGTGGCTGGCAGG + Intronic
1075112073 10:119596141-119596163 TCTGCACGGCTGAGGCTGTCAGG - Intronic
1075679716 10:124323455-124323477 TCTGCAGGGCAGAGGCTGCAGGG - Intergenic
1076357592 10:129864326-129864348 GCTGCCTGTCACTGGCTGGCAGG - Intronic
1076359324 10:129875809-129875831 TCCTCCAGGCAGAGGCTGCCAGG - Intronic
1076859613 10:133134467-133134489 CCTGTCTGGGAGAGGCTGGGGGG - Intergenic
1077094486 11:793498-793520 TCTGCCTGGCAGACACTCGAGGG - Intronic
1077167897 11:1152035-1152057 TCAGCCTGGCTCTGGCTGGCAGG - Intergenic
1077225355 11:1437028-1437050 GCTGCCTGGATGGGGCTGGCAGG + Intronic
1077393922 11:2311996-2312018 GCTGCTTGGCAGAGCCAGGCAGG + Intronic
1077421363 11:2451645-2451667 TCTGCCTGGCCGCCTCTGGCAGG + Intronic
1079344761 11:19642219-19642241 TGTGCCTGGGTGGGGCTGGCTGG - Intronic
1080801470 11:35614082-35614104 GCTGTCTGCCCGAGGCTGGCTGG + Intergenic
1081599625 11:44484182-44484204 TCAGGCTGGCGGAGCCTGGCAGG - Intergenic
1081860944 11:46333079-46333101 TGCGCCTGGGAGAGGCGGGCCGG - Intronic
1082490881 11:53532166-53532188 GGAGCCTGGGAGAGGCTGGCAGG - Intergenic
1083207453 11:61161269-61161291 TCTGCCAGGATGAGGCGGGCAGG + Intronic
1083298956 11:61730331-61730353 GCCACCTGGCAGAGGCTGCCAGG + Intronic
1083455942 11:62778642-62778664 TCCGTCTGGCAGAGGGTGGGTGG + Intronic
1083632016 11:64100710-64100732 TCTGGCTGGCAGTGGTTGGGAGG - Intronic
1084480637 11:69417890-69417912 TCTGCCTGGGAGAGGCGGGGAGG + Intergenic
1085960471 11:81455698-81455720 TCTGCCTGGAACTGGCTGTCTGG + Intergenic
1086726311 11:90189076-90189098 TCTTCCTGTAAGAGGCAGGCAGG + Intronic
1087009182 11:93497503-93497525 GCTGCCTGGCTGAGGGTGGAGGG + Intronic
1088924195 11:114284192-114284214 TCTGCCTGGCACAGAGAGGCTGG - Intronic
1089191340 11:116655640-116655662 TGTGTGTGCCAGAGGCTGGCAGG - Intergenic
1089587476 11:119519684-119519706 TCTGCCTGGCTCAGGAGGGCGGG + Intergenic
1089773060 11:120816942-120816964 ACGGCCTGGGAGAGGCTGGGAGG - Intronic
1089774847 11:120828950-120828972 GCTGCCTGGCAGAGGCTGCCGGG - Intronic
1090184693 11:124729423-124729445 TATGAATGGCAGTGGCTGGCTGG - Intergenic
1090226233 11:125073770-125073792 TGTCCCTGGGAGTGGCTGGCAGG + Intronic
1090271569 11:125389600-125389622 ACTGCCAGTCAGAGGCTGGTGGG - Intronic
1090806952 11:130208783-130208805 TCTGCCAGGCAGAGGGAGACTGG - Intronic
1091323445 11:134667435-134667457 GCAGCCTGGCGCAGGCTGGCAGG + Intergenic
1091918960 12:4289309-4289331 GCTGCCGGGCAGAGGCAGCCTGG - Intronic
1092864867 12:12751278-12751300 TCTGGCTGGCATAGGCTGAATGG + Intronic
1092936393 12:13367973-13367995 TCTGCTTGGCAGTTGCTGTCTGG + Intergenic
1095405891 12:41866814-41866836 TGAGCCTGGAGGAGGCTGGCAGG - Intergenic
1097189885 12:57214609-57214631 GCTGGCTGGCAGAGGGTGGAGGG - Intergenic
1098170870 12:67745796-67745818 TCTGCCTCACAAAAGCTGGCTGG - Intergenic
1098377793 12:69836165-69836187 TCTGCCGGTCAGGGGCTAGCCGG + Intronic
1101324526 12:103703510-103703532 TGTGCCTGGGAAAGGCTGCCAGG + Intronic
1101778691 12:107816552-107816574 TCTGCCAGCAGGAGGCTGGCTGG - Intergenic
1102544680 12:113645974-113645996 TGAGCCTGGCAGAGGCTGACAGG + Intergenic
1102722404 12:115028676-115028698 CCTGCCTGGCTGAGGGTGTCAGG + Intergenic
1103913692 12:124365229-124365251 TCTGGGTGCCAGAAGCTGGCAGG + Intronic
1103972967 12:124683543-124683565 GCTGCCTGGCGGAGGCTGGAAGG - Intergenic
1104759096 12:131286469-131286491 GCTTCCTGGGAGAGGCGGGCAGG + Intergenic
1104821514 12:131680027-131680049 GCTTCCTGGGAGAGGCGGGCAGG - Intergenic
1105038038 12:132940681-132940703 CCTGCCAGTCTGAGGCTGGCCGG - Intronic
1105836361 13:24215768-24215790 TCTGCTTGGCAGAGGCAGACTGG - Intronic
1106008226 13:25791604-25791626 TCTGCCTGGAAGTTGCTGGAAGG + Intronic
1106226520 13:27790668-27790690 TCCGCTGGGCAGAGGCAGGCTGG - Intergenic
1107011964 13:35678762-35678784 TCTGCCTCCCAGGGGCAGGCCGG + Intergenic
1107146136 13:37062165-37062187 TCTGCCTGGAAGAGCATGCCTGG - Intergenic
1107870405 13:44741401-44741423 TTTGGCAGGCAGAGGCAGGCTGG - Intergenic
1108046219 13:46387120-46387142 TTTGGCTGGGTGAGGCTGGCGGG - Exonic
1109886187 13:68548311-68548333 GCTGCTTGACAGAGGCTGGAAGG - Intergenic
1113465215 13:110507861-110507883 TGGGCCTGGCTGGGGCTGGCAGG + Intronic
1113753344 13:112791506-112791528 TACCCCTGGCAGGGGCTGGCGGG + Intronic
1114065145 14:19053893-19053915 AGAGCATGGCAGAGGCTGGCAGG + Intergenic
1114097118 14:19346109-19346131 AGAGCATGGCAGAGGCTGGCAGG - Intergenic
1114160838 14:20165307-20165329 TCTGCTTGGCAGTTGCAGGCAGG + Intergenic
1114544223 14:23486721-23486743 TCTGCCTGGCCTAGGCTGTGTGG + Intronic
1115645992 14:35368848-35368870 TCTTTCTGGCAGAGTCTGGGAGG - Intergenic
1116777909 14:49202729-49202751 TGTGCCTGGGAGTGGCTAGCAGG - Intergenic
1117764364 14:59064964-59064986 TCTGCCTGTCAGAGTGTGGTAGG - Intergenic
1117897838 14:60506797-60506819 TCTGCGTGTCTGAGGCTCGCGGG - Intronic
1117913158 14:60653204-60653226 TCTGCCTGGCTGAGGGGAGCAGG + Intronic
1118868409 14:69721219-69721241 GCTGCCTGGCTGTTGCTGGCAGG - Intergenic
1119406601 14:74403049-74403071 TCAGGCTGGCAGAGACAGGCTGG - Intergenic
1119420243 14:74503849-74503871 ACTGGCTGGCAGGGGCTGGGTGG + Intronic
1121021282 14:90581641-90581663 TCTAACTGGGAGAGGCTGGGCGG - Intronic
1121127320 14:91416904-91416926 TCTCCCAGGCAGAGACTGGACGG + Intronic
1121564898 14:94901884-94901906 TCTGCTTTGCAGAAGCTGGGAGG + Intergenic
1121696565 14:95917974-95917996 TCTTCCTGCCAGGGGCTGGGTGG - Intergenic
1121732301 14:96195110-96195132 CCTGCCTGGCAGGGCCTGGCTGG + Intergenic
1122268358 14:100557125-100557147 TGTGGCTGGAAGAGGCCGGCAGG - Intronic
1122282830 14:100634331-100634353 TGAGCCTGGCAGAGGCTTTCTGG + Intergenic
1122324532 14:100874657-100874679 CATGCCGGGAAGAGGCTGGCAGG - Intergenic
1122337649 14:101004471-101004493 GCTGCCTGGCAGAGCCTCCCCGG + Intergenic
1122350757 14:101088580-101088602 TGGGCCTGGCAGGGCCTGGCAGG + Intergenic
1122362394 14:101175150-101175172 TCTGCCTGGCAGGTGTGGGCAGG + Intergenic
1122577349 14:102750745-102750767 TCTCCTGGGGAGAGGCTGGCTGG + Intergenic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1122794043 14:104196892-104196914 TCTGCCAGGCAGCGGCTCCCTGG + Intergenic
1122891258 14:104733269-104733291 TCTGCCTGGCCCTGCCTGGCTGG - Intronic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1124105062 15:26729798-26729820 TGGGCATGGCAGAGCCTGGCAGG - Intronic
1124136150 15:27037978-27038000 TCTGCTGGCCAGAGCCTGGCTGG - Intronic
1124182676 15:27491362-27491384 GCTGCCTGTCTGAGGCTGGGAGG - Intronic
1124642123 15:31402261-31402283 TCTTCCTTTCAGAGGCTGGCGGG - Intronic
1125518060 15:40333954-40333976 TCTGCCAGGCAGAGGTGGGAGGG + Exonic
1125610142 15:40964151-40964173 TATGCCAGGCAGAGGGTGGCAGG + Intergenic
1126796119 15:52261599-52261621 GCTGCCAGGCAGAAGCTGGTGGG + Intronic
1128512197 15:68320142-68320164 TGTGCCAGGCAGAGGCAGTCTGG + Intronic
1128737686 15:70062529-70062551 CCTGCCAGCCAGAGGCGGGCTGG - Intronic
1129322374 15:74782304-74782326 TCCGGCGGCCAGAGGCTGGCTGG - Exonic
1129696306 15:77742309-77742331 TCTGCCTCCCAGAGGCTGTGGGG - Intronic
1130230850 15:82095380-82095402 TTTGCCTGGCCTAGGCTGGAAGG - Intergenic
1130292349 15:82613974-82613996 ACTGCTTGGCGGAGGCTTGCCGG - Intronic
1130889822 15:88124302-88124324 TCTGCCTGGGAGAGGGGAGCAGG + Intronic
1131071523 15:89469485-89469507 TCTGCATGGCAGTTGCTGCCTGG + Intergenic
1132201117 15:99955476-99955498 ACTGCCTCCCAGAGGCTGGATGG - Intergenic
1132502015 16:288666-288688 AGAGCCTGGCAGAGCCTGGCGGG - Intronic
1132661397 16:1063054-1063076 CCCACATGGCAGAGGCTGGCGGG - Intergenic
1132672159 16:1106381-1106403 GCTGCCTGGCAGAGTCTGGATGG + Intergenic
1132789971 16:1680269-1680291 GCTGCCTGGCACTGGCTGCCCGG + Intronic
1133118299 16:3590735-3590757 TCTGCCTGGCAGTCCCTGGAAGG + Exonic
1133695008 16:8254672-8254694 TCTGCCTGGAACAGGATAGCTGG + Intergenic
1134102240 16:11460634-11460656 GCTGCCTGGCAGAGGAGGGCAGG - Intronic
1134248099 16:12554994-12555016 TCTTTCTTGCAGAGGCAGGCAGG + Intronic
1134291901 16:12908300-12908322 TCTGAGTGGGAGGGGCTGGCAGG + Intronic
1134333222 16:13269518-13269540 CCTGCTTGGCAGAGGCTCACTGG - Intergenic
1134450266 16:14358974-14358996 TCTGCTGGGCAGAGCCTTGCTGG - Intergenic
1135060393 16:19266636-19266658 TCTGGCTGGCATGGGATGGCAGG + Intronic
1135220542 16:20611139-20611161 TCTGCCTGGCTGAGAGAGGCTGG + Intronic
1135252726 16:20914717-20914739 TCTACATGGCAGCTGCTGGCTGG + Intronic
1135964325 16:27023295-27023317 TCTGGCTGGGCTAGGCTGGCTGG - Intergenic
1136221887 16:28834537-28834559 TCGGCGGGGCTGAGGCTGGCTGG - Exonic
1136298464 16:29317363-29317385 GCTGCCTGGCTGAGCCTGGAAGG + Intergenic
1136395036 16:29987901-29987923 AGTCCCTGGCAGTGGCTGGCGGG - Exonic
1137983128 16:53086441-53086463 TCTGTTTGGCAGGGGCTGACAGG - Intronic
1138510945 16:57508153-57508175 GCTGCCTGGTAGAGTCAGGCTGG + Intergenic
1138539402 16:57679330-57679352 TCTGCCCTGCAGTGGCTGCCAGG - Intronic
1139372964 16:66479933-66479955 TCTGCCTGAGGGGGGCTGGCAGG - Intronic
1139614426 16:68080325-68080347 TCTGCCTGTGTGAGGCTGGCTGG + Intergenic
1139891623 16:70256766-70256788 CCTGCCTGCCAGAGGCCTGCAGG + Intronic
1139939980 16:70598222-70598244 TGTGCCTGGAAGGGCCTGGCAGG - Intronic
1139950409 16:70665540-70665562 TCTGCCATGCAGAGGCCAGCAGG + Exonic
1139964416 16:70737562-70737584 ACTTCCTGCCAGGGGCTGGCAGG - Intronic
1140495400 16:75382440-75382462 TCTGCCTGGCTTAGGCTTGCAGG + Intronic
1141062487 16:80886719-80886741 TGTGCATGGCTGAGGGTGGCAGG + Intergenic
1141092695 16:81141182-81141204 TCTGCCTGGCAAGGTCTGGGTGG + Intergenic
1141217156 16:82035359-82035381 TCTAGCGGGCAAAGGCTGGCTGG - Exonic
1141577425 16:84973116-84973138 TGCCCGTGGCAGAGGCTGGCTGG + Intergenic
1141717318 16:85734427-85734449 TCTGCCTGGAAGGGGCTGCTGGG + Intronic
1141732258 16:85830392-85830414 GCTTCCTGGGAGAGGCAGGCTGG - Intergenic
1141832112 16:86515692-86515714 TCTGGCCTGCAGAGGCTGACCGG - Intergenic
1141887986 16:86905958-86905980 TCTGCCTAGCAGACACTGGCTGG - Intergenic
1142060126 16:88023858-88023880 GCTGCCTGGCTGAGCCTGGAAGG + Intronic
1142274621 16:89111284-89111306 GCTGCCTGGCAGAGAAAGGCAGG - Intronic
1142351481 16:89582784-89582806 ACTGCCTGGCGGATGCTGGGAGG - Intronic
1142552188 17:747624-747646 TCTGCATGGCAGATGGTGGTGGG + Exonic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1144066351 17:11627922-11627944 TCAGGCTGGCACAGGCTGCCTGG - Intronic
1144560347 17:16316015-16316037 ACTGCCTGGCAGAGCCTGAGAGG - Intronic
1144711508 17:17404377-17404399 TCTGCCAGGCTGAGTCTTGCTGG + Intergenic
1144943070 17:18954631-18954653 TGGGCCTGGGAGAGTCTGGCGGG + Intronic
1145750856 17:27354042-27354064 TCTCCCGGGGAGAGCCTGGCTGG + Intergenic
1145767443 17:27468632-27468654 TCAGCCTGGAAGCGGATGGCTGG - Intronic
1146056422 17:29583606-29583628 TCACCCTGGCAGACCCTGGCTGG - Exonic
1146937882 17:36823937-36823959 CCTCTCTGGCTGAGGCTGGCAGG - Intergenic
1147184619 17:38706356-38706378 CCTGCCTGGCACAGGCAGCCGGG + Intronic
1147339950 17:39747295-39747317 TCTGTCTGGCAAGGCCTGGCTGG + Intergenic
1147952016 17:44112652-44112674 CCTGACTGGCAGAAGCTGGCTGG - Intronic
1148020050 17:44547686-44547708 TCTGCCTGGGCCAGGCTGCCTGG + Intergenic
1148071846 17:44913229-44913251 GCTGCCTGGAGGAGGCAGGCTGG + Intronic
1148074442 17:44927412-44927434 CCTGTGGGGCAGAGGCTGGCAGG - Intronic
1148788074 17:50155669-50155691 TGCGCCAGGCAGAGCCTGGCGGG - Intergenic
1149441771 17:56680124-56680146 GCTTCCTGGCATAGGGTGGCGGG - Intergenic
1149857091 17:60092292-60092314 TATGAGTGGCAGAGGCTGGCTGG + Intergenic
1151519457 17:74617753-74617775 CATGCCTGGCAGAGGCTGCAGGG - Intronic
1151624948 17:75270837-75270859 TCTCCCTGGGACAGGCTGGTCGG + Intronic
1151680506 17:75620398-75620420 TCCACTTGGCAGAGGCTGCCCGG + Intergenic
1151977346 17:77490232-77490254 TGTGGGTGGCAGGGGCTGGCAGG - Intronic
1152065915 17:78112449-78112471 TCTGGCTGCCAGCAGCTGGCTGG - Exonic
1152272497 17:79333152-79333174 CCTCCCTGGTAAAGGCTGGCAGG - Intronic
1152636106 17:81431126-81431148 TCTGGCTGAGAGAAGCTGGCGGG - Intronic
1153340382 18:3967246-3967268 AGTGCCTGGCAGTGCCTGGCTGG - Intronic
1154009612 18:10563875-10563897 TTTGCCAGGCTGAGGCTGGGTGG + Intergenic
1155537681 18:26833690-26833712 TCTCCCCAGGAGAGGCTGGCTGG + Intergenic
1155914075 18:31538878-31538900 TCTGCATGGCAGCGGCTGCAGGG + Exonic
1156157525 18:34321148-34321170 GCTGCTTGGAAGAGGCTAGCAGG + Intergenic
1156350182 18:36296827-36296849 CCCGCCTGGCAGGGGCGGGCAGG + Intergenic
1156478352 18:37420584-37420606 TCTGCCTGGCAGGCTGTGGCAGG + Intronic
1157694169 18:49707795-49707817 ACTGCAGGGCAGAAGCTGGCTGG - Intergenic
1158069989 18:53459401-53459423 TCTGACTGGCTGTGGCTGACTGG - Exonic
1159053899 18:63446498-63446520 TCTGCCTGCCTGGAGCTGGCCGG + Intergenic
1160580963 18:79884422-79884444 CCGGCCTGGCAGGGACTGGCTGG + Intronic
1160803040 19:979388-979410 CCATCCTGGCCGAGGCTGGCCGG + Intergenic
1160810975 19:1012802-1012824 TCTCCCTGGCTGGGGCTGGCTGG + Intronic
1161287203 19:3474815-3474837 ACTGCCTGGAAGAGGCAGCCAGG + Exonic
1161772939 19:6241267-6241289 TCTGCCTGGCAGTGGCTTGGGGG - Intronic
1161776231 19:6263738-6263760 TCTGCCTTTCAGAAACTGGCAGG - Intronic
1161785052 19:6319362-6319384 CCCGCCTGGCAGAGCCTGGGTGG - Intronic
1161801888 19:6420961-6420983 TCTTCCTGGAAGAGGCTAGGAGG - Intronic
1162531388 19:11238181-11238203 ACTGACCGGCAGAGCCTGGCTGG + Exonic
1162563375 19:11431010-11431032 CCTGCCTGCCAGAGGGTGACCGG - Exonic
1162792330 19:13069543-13069565 CCTGCCTGGCAGGGACTGCCAGG + Intronic
1163640846 19:18461193-18461215 CGTGCCTGGCAGAGCCTGGCAGG - Intronic
1163763718 19:19150850-19150872 TCTTCCTCTCAGTGGCTGGCAGG - Intronic
1165137213 19:33677253-33677275 TCTGCCAGGCAGGGGCAGGTGGG - Intronic
1165214947 19:34264309-34264331 TCTGCCTGCCTCAGGCTGGCTGG - Intronic
1165917630 19:39270295-39270317 TCTGCAGGTCAGAGGCTCGCTGG + Intergenic
1166283496 19:41810080-41810102 TCTGCCTGGCAGTGACTGGCAGG - Intronic
1167572599 19:50298521-50298543 TCTGGGAGGCCGAGGCTGGCAGG + Intronic
1168134520 19:54341513-54341535 TCTCCATGGCAGAGGCTGGAGGG + Intergenic
1168241429 19:55091060-55091082 CCCACCTGGCTGAGGCTGGCGGG + Exonic
925132820 2:1505382-1505404 TGTGCCTGACACAGGCTGGTGGG - Intronic
925535117 2:4908612-4908634 GCTCCCTGGAGGAGGCTGGCAGG + Intergenic
925635915 2:5941356-5941378 TCAGCCTGGCGCAGGGTGGCTGG + Intergenic
926076163 2:9944698-9944720 TCATCCTGGCAGTGGCAGGCAGG + Intergenic
926313071 2:11688444-11688466 TCTGCATGGCAGTGGCTGGGAGG + Intronic
928638316 2:33270621-33270643 CCTGCCTGGCAAAGGATGGAAGG + Intronic
929455895 2:42065250-42065272 TTTGGGTGGCTGAGGCTGGCGGG + Intergenic
929983232 2:46699601-46699623 TCTGGCTGGGATGGGCTGGCCGG + Intronic
931188310 2:59975156-59975178 TCAGATTGCCAGAGGCTGGCAGG + Intergenic
931344228 2:61431557-61431579 TTTAGCTAGCAGAGGCTGGCCGG + Intronic
932429771 2:71667364-71667386 TCTCTGGGGCAGAGGCTGGCAGG + Exonic
933991182 2:87634897-87634919 TCTGGCTGGTAGAGGCAGGAGGG + Intergenic
934131713 2:88955000-88955022 GCTGCCTGGCAGGGGCTTGAGGG + Intergenic
934502312 2:94870621-94870643 GCTGCCTGGCGGAGGCTGGATGG - Intergenic
934677271 2:96258451-96258473 TTCGCCCAGCAGAGGCTGGCTGG + Intronic
935207004 2:100904837-100904859 TCTGCCTGGCAGAATCTCGCTGG + Intronic
936028658 2:109053870-109053892 TCTGCCTGGCACCGGCTCACAGG + Intergenic
936046148 2:109189312-109189334 TCTGCCTGGTAGATGGTGGGGGG - Intronic
936118488 2:109721749-109721771 TCTGACTGGCAGACACTAGCGGG - Intergenic
936302657 2:111315926-111315948 TCTGGCTGGTAGAGGCAGGAGGG - Intergenic
936354241 2:111736590-111736612 TTTGCATGGCAGAGGGTGACTGG + Intergenic
937205915 2:120237090-120237112 GGCGCCTGGCAGAGGCTGGAGGG + Intergenic
937547353 2:123038915-123038937 TCTGATTGGCCGAGGCTGGTGGG - Intergenic
937923670 2:127151154-127151176 ACTGCCTGGCTGAGGGTTGCAGG - Intergenic
938411585 2:131069103-131069125 ACTGCCTAGCAGAGGCAGGGTGG - Intronic
938482398 2:131672896-131672918 AGAGCATGGCAGAGGCTGGCAGG + Intergenic
938639861 2:133266859-133266881 TCTGCCTGGGAGCGCCCGGCGGG + Intronic
942228611 2:173838577-173838599 TTTGGCTGGAACAGGCTGGCAGG - Intergenic
944285848 2:197949034-197949056 TCTGCATGCCAGAGCCTGCCAGG + Intronic
944348515 2:198698657-198698679 TCTTCATGCCAGACGCTGGCAGG + Intergenic
945718953 2:213394539-213394561 TCTGCCTGCCAGAGGATCCCTGG + Intronic
946737759 2:222771749-222771771 TCTGGGAGGCAGAGGCGGGCTGG - Intergenic
947795000 2:232889079-232889101 GCTGCCAGGCAGAGGCGGGCAGG - Intronic
948447817 2:238046650-238046672 TCTTCAGGGCAGTGGCTGGCAGG - Intronic
948598192 2:239093796-239093818 TCTGCCTTGCACAGGCGTGCTGG + Intronic
948653851 2:239464861-239464883 AGTGCATGGCAGAGGCTGGGAGG + Intergenic
948863988 2:240766250-240766272 TCTGCAGGCCAGAGGCTGGCTGG + Intronic
948983654 2:241507790-241507812 TTTGCGTGGCAGAAGCTCGCAGG - Intronic
1168986416 20:2052858-2052880 TCTGCCTTGCAGATGAGGGCTGG - Intergenic
1169141678 20:3230344-3230366 TCTTCCTGGCAGGGGGAGGCAGG - Intronic
1169374981 20:5059250-5059272 TCTGAATGACAGAGGCTGGGAGG - Intergenic
1172057722 20:32165981-32166003 GAGGTCTGGCAGAGGCTGGCTGG - Exonic
1172117616 20:32582091-32582113 CCTGCCTGGCTCCGGCTGGCTGG + Intronic
1172233452 20:33352837-33352859 TCTTGCTGTCAGAGGCTGACCGG - Intergenic
1172795971 20:37537856-37537878 TATCCCTGGCAGATGCTGTCCGG + Intergenic
1174075433 20:47932200-47932222 TATGCCTGGCAGAGGCTGGGAGG + Intergenic
1174475811 20:50795045-50795067 TCCGGCTGGCGGAGGCTGCCTGG - Exonic
1175076827 20:56382359-56382381 TCTGCCTGGCAACACCTGGCTGG - Intronic
1175414404 20:58792416-58792438 TCTGCCAGCCAGAGCCTGGATGG + Intergenic
1175823928 20:61926406-61926428 GCTGGCTGGGGGAGGCTGGCAGG - Intronic
1175877025 20:62235221-62235243 CCTGGCTGGCAGCTGCTGGCTGG - Intronic
1176145722 20:63564578-63564600 ACGTCCTGGCAGAGGCTGGCCGG + Exonic
1176413383 21:6461031-6461053 TCTCCCTGGGGGAGGATGGCAGG - Intergenic
1176623703 21:9074547-9074569 GCTGCCTGGCGGAGGCTGGATGG + Intergenic
1178881853 21:36456131-36456153 TCTGCCTGGCAGTGGGGGACAGG + Intergenic
1179012198 21:37564457-37564479 TCTTCCTGGCAGAAGGTGGCAGG + Intergenic
1179165388 21:38931645-38931667 TCTGCTTTGCAGCGGCAGGCAGG - Intergenic
1179688880 21:43069354-43069376 TCTCCCTGGGGGAGGATGGCAGG - Intronic
1179987978 21:44931862-44931884 TCTCCCTAGCGGAGGCTGGGCGG + Intronic
1180163110 21:46006810-46006832 CATGCCTGGCAGGGGCTGGGAGG + Intergenic
1180483635 22:15776513-15776535 AGAGCATGGCAGAGGCTGGCAGG + Intergenic
1180720944 22:17907974-17907996 TCTGCTGGACAGAGGCTGGGAGG + Intronic
1180879898 22:19196217-19196239 AGGGCCTGGCAGAGGCTGGCAGG + Intronic
1181019312 22:20090475-20090497 TCTGCATGGCTGAGGCTGCTGGG + Intronic
1181048798 22:20229022-20229044 TCTGGCTGGCATGGGCTGCCTGG + Intergenic
1181443739 22:22952557-22952579 TCTGCCAGCAGGAGGCTGGCTGG - Intergenic
1181462443 22:23093805-23093827 TCTGGCTGTCAGAGGCTGGCAGG + Intronic
1183932025 22:41240776-41240798 TGGGCCTCTCAGAGGCTGGCGGG - Intronic
1184150057 22:42632562-42632584 GCTGCCTGGGAGAGGTTGGTGGG - Intronic
1184200164 22:42963045-42963067 TCTGCATGCCAGAGGCCAGCAGG - Intronic
1184278740 22:43425551-43425573 TCCTCCTGGCAGCGTCTGGCGGG + Intronic
1184640250 22:45866763-45866785 TTTGCCGGGCACAGGCAGGCCGG - Intergenic
1184664663 22:45981952-45981974 TCTGCCTGGCACAGGCCTGTAGG - Intergenic
1184721682 22:46318235-46318257 TCTGCCTGACAGAGGAGGCCAGG - Intronic
1184794931 22:46726697-46726719 TCTCCCTGGCAGTGGTGGGCAGG - Intronic
1185116129 22:48939460-48939482 CCGCCCTGGGAGAGGCTGGCAGG - Intergenic
1185195722 22:49468126-49468148 TCTCTCTGGGAGAGACTGGCAGG - Intronic
1185315921 22:50179056-50179078 TCCGCCTTGCCCAGGCTGGCTGG - Exonic
950182842 3:10927266-10927288 CCTGCCTGGCAGAGGGAGGCAGG + Intronic
950461274 3:13123605-13123627 TGTACCTGACAAAGGCTGGCTGG - Intergenic
950599361 3:14018393-14018415 TCTGCCTGGCAGAAGCCCGTGGG + Intronic
952010992 3:28901245-28901267 TCTGCCAGTAAGTGGCTGGCTGG + Intergenic
952669023 3:35943926-35943948 TCTGCCTGGCTGAGGATGTGTGG + Intergenic
953421147 3:42754240-42754262 ACTGCCTCGCCCAGGCTGGCAGG - Intronic
954629026 3:52038314-52038336 GCTCCTTGGCAGAGGCTGCCAGG - Intergenic
954956948 3:54529616-54529638 TCTCCCTGGCAGAGGTTTACAGG + Intronic
956910398 3:73810153-73810175 CCTACCTGCCAGAGGGTGGCGGG + Intergenic
956929529 3:74027323-74027345 TTTGGCTGGCAGTGGGTGGCGGG - Intergenic
957024044 3:75159456-75159478 TCTGCCAGGCTGAGGCGGGCAGG - Intergenic
961449846 3:126997767-126997789 TCTGCTTCCCAGTGGCTGGCAGG + Intronic
961512785 3:127413276-127413298 TCTCCCTGGCAGAGGGTGACAGG - Intergenic
962635781 3:137330126-137330148 TCTGCATGGGAGAGGCTGGGAGG - Intergenic
963262541 3:143207317-143207339 TCTGCCTGGCCCTGGCTGCCGGG + Intergenic
963680185 3:148364662-148364684 TGTGCCTGGCACAGGCTTCCTGG - Intergenic
963900710 3:150730569-150730591 TCTGGCAGGCCAAGGCTGGCAGG - Intergenic
965193886 3:165568710-165568732 GCTGACTGCCAGGGGCTGGCTGG + Intergenic
965862294 3:173161310-173161332 TCTGGCTGGCAGGGGTTGGGGGG + Intergenic
965941164 3:174183231-174183253 TCTGCCTGGCAGGAGAAGGCAGG - Intronic
966240627 3:177752030-177752052 TCAGCATGTCAGATGCTGGCTGG - Intergenic
967751789 3:193123477-193123499 TCTGCATGGCAATGACTGGCTGG - Intergenic
967814560 3:193788015-193788037 GGGGCCTGGCAGGGGCTGGCGGG + Intergenic
968461244 4:726076-726098 GCTGTGGGGCAGAGGCTGGCGGG + Intronic
968693737 4:2009873-2009895 TCTGGGAGGCAGAGGCGGGCGGG - Exonic
969289436 4:6229312-6229334 GCTGCCTGCCAGCGGATGGCAGG + Intergenic
969321119 4:6413524-6413546 CCTGCCGGGCAGATGCTGGTGGG + Intronic
969475437 4:7420086-7420108 TCTGGCTGACAGAGTGTGGCTGG - Intronic
969591642 4:8125731-8125753 TTTCCATGGCAGAGGCTGGGCGG - Intronic
973961746 4:56117466-56117488 TCTGATTGCCAGAGGCTGGAAGG + Intergenic
976444471 4:85114761-85114783 GCTTCCTGCCAGAGGCTGCCGGG - Intergenic
977697744 4:99985545-99985567 TCTGGCTGCCAGAGGCCAGCAGG + Intergenic
978705733 4:111708243-111708265 TCTGGGAGGCTGAGGCTGGCAGG - Intergenic
979899816 4:126201936-126201958 TCAGCCTGGCAGACACAGGCCGG - Intergenic
980807456 4:137831821-137831843 CCTTCCTGGCAGAGTCTGCCAGG + Intergenic
981241360 4:142480305-142480327 TTTGCCTGACAGAGGCAGGAGGG + Intronic
983090078 4:163493095-163493117 TCTGCATGGCAGTTGCTGCCTGG + Intergenic
983329979 4:166313670-166313692 TGTGTTTGGCAGAGGCTGGTGGG - Intergenic
983730840 4:170991740-170991762 GGAGCCTGGGAGAGGCTGGCAGG + Intergenic
984858656 4:184217747-184217769 TCCGGCGGGCAGAGGCTGGCTGG + Exonic
985383367 4:189419384-189419406 TGTGCCCGGCAGAGCCTGGGTGG + Intergenic
985476486 5:82177-82199 TCAGCCTGGCAGATGCTGTGTGG - Intergenic
985548304 5:520837-520859 TGTGCCTTGCAGAGACTGCCAGG - Intronic
985660534 5:1154981-1155003 TCTGTGTGGCCAAGGCTGGCGGG + Intergenic
985833687 5:2255001-2255023 TCTTCCTGAAATAGGCTGGCTGG + Intergenic
985972285 5:3388035-3388057 CCTCCCTTGGAGAGGCTGGCAGG + Intergenic
986108421 5:4685270-4685292 TGAGCCTGGCAGAGGTTGCCAGG - Intergenic
986173384 5:5331896-5331918 GCTGCCTGGGTGAGTCTGGCAGG - Intergenic
986602221 5:9483916-9483938 TCTGCCTGACACAGGCTGTGTGG + Intronic
987027937 5:13946494-13946516 TCATTCTGGCAGGGGCTGGCGGG - Intergenic
987123697 5:14791805-14791827 CCTGCGTGGCAGAGGTTTGCTGG - Intronic
990472423 5:56128421-56128443 GCTGCCTGGGACTGGCTGGCAGG - Intronic
991544867 5:67770628-67770650 TCTGCCTGGTAAACTCTGGCAGG + Intergenic
992444323 5:76820093-76820115 TCTGCAGGCCAGAGGCTGGCTGG + Intronic
993099382 5:83518619-83518641 TGTGCCTGGCAGAGGCTAGTCGG - Intronic
993622440 5:90185096-90185118 TCTGCCTGGCATAAGCTTCCAGG - Intergenic
995845082 5:116484875-116484897 GCTGCATGGCAGAGGATGGGAGG + Intronic
997198903 5:131997904-131997926 TCTGCCTTGCAGTGGCTCCCAGG - Intronic
997430411 5:133835184-133835206 GCTGCCTTGAAGAGGCAGGCGGG + Intergenic
997627490 5:135340871-135340893 TCTGCCTGGCAGATGTGGCCTGG + Intronic
997962768 5:138335207-138335229 TCTGCCCTGCAGAGGCTGGCTGG - Intronic
997983083 5:138482158-138482180 TCTGTCTGTTAGAGGCTGGCGGG + Intergenic
998132010 5:139656000-139656022 TCTGCCAGACAGAGGAGGGCGGG - Intronic
998252843 5:140564260-140564282 GCGGGCCGGCAGAGGCTGGCGGG - Exonic
999966833 5:156819181-156819203 TCTGCCTGGCAGGGACTAGGTGG + Intergenic
1000035851 5:157447383-157447405 TCCGCCTGGCACTGGCTGGGCGG + Intronic
1000707771 5:164532981-164533003 ACTGCCAGGCAGCAGCTGGCTGG + Intergenic
1001232557 5:170001196-170001218 TCTGCCCTGCAGAGGAGGGCAGG + Intronic
1001269912 5:170303150-170303172 GTTGCCTTGCACAGGCTGGCCGG - Intergenic
1001454315 5:171848890-171848912 CCTGCCTGGCAGAGACCGGCTGG - Intergenic
1001542346 5:172548396-172548418 TCTAGCTGTCAGAGGCTGGGCGG - Intergenic
1001917766 5:175575896-175575918 TCTGCCTGGAACAGGCAGACTGG + Intergenic
1002437602 5:179241343-179241365 TGTGCCTCACAGAGGCTGGCTGG - Intronic
1002442227 5:179270442-179270464 TGGCCCTGGCAGAAGCTGGCAGG - Intronic
1002470126 5:179430092-179430114 TCTGCCTGGCAGGGGCTCTATGG + Intergenic
1002576346 5:180176264-180176286 TCTGCCTGCCAGAAGCCTGCAGG - Intronic
1003351144 6:5318850-5318872 TCTGCATGGCAGTTGCTGACTGG - Intronic
1003730808 6:8821475-8821497 AGAGCCTTGCAGAGGCTGGCAGG + Intergenic
1006011035 6:31043082-31043104 TCTGCCTGTGTGAGGCTGGAAGG - Intergenic
1006392095 6:33764461-33764483 AGTGGCTGGCAGGGGCTGGCAGG - Intergenic
1006926323 6:37657443-37657465 TGGCCCTGGAAGAGGCTGGCAGG - Intronic
1008125620 6:47665204-47665226 TCTGACTGTCAGAGGCTGCCAGG - Intronic
1009435302 6:63610742-63610764 TTTGGGAGGCAGAGGCTGGCGGG + Intergenic
1011251465 6:85376503-85376525 TCTGCATGGCAAAAACTGGCTGG + Intergenic
1011340885 6:86313167-86313189 TGTTCCTGGCAGAGGCTGCATGG + Intergenic
1012547435 6:100435591-100435613 TCTGTCTGGGAGAGACTGGGAGG - Intronic
1012909256 6:105101175-105101197 TCATCTTGGCAGAGGCTCGCTGG + Exonic
1013318056 6:108960247-108960269 TGTGCTTGGCAGAGACTGGATGG - Intronic
1013617405 6:111858000-111858022 TCTCCCTGCTGGAGGCTGGCTGG - Intronic
1015931692 6:138366944-138366966 TCTGGCTGGCAGGGGTTGGGGGG + Intergenic
1016356371 6:143223127-143223149 TCTGCTAGACAGAGGCTGGCTGG - Intronic
1016889927 6:148995781-148995803 TTTGTGTGGCAGAGACTGGCTGG + Intronic
1018726556 6:166617025-166617047 TCTGCCTGACAGAAGGTGCCGGG + Intronic
1018753898 6:166831449-166831471 TCTGTCTGGCAGGGGCAGGGGGG - Intronic
1018898386 6:168037315-168037337 TCAGCCTGGCAGCGCCTGGGTGG + Intronic
1019217150 6:170451369-170451391 CGTGCCTGGCAGAGGATGGTAGG + Intergenic
1019477778 7:1252277-1252299 ACTGCCTGGCTCAGGCTGGGAGG + Intergenic
1019643527 7:2117076-2117098 TAGGCCTGGCAGAGGCAGCCAGG + Intronic
1019774284 7:2903193-2903215 TGTCCCAGGCAGTGGCTGGCTGG - Intergenic
1021128662 7:16883885-16883907 TTTGCTTTGCAAAGGCTGGCTGG - Intergenic
1021855146 7:24848005-24848027 TCTGTCTGGCAGAAGCTTGTGGG - Intronic
1021969401 7:25951497-25951519 GCAGCCTGGCAGAGGCTGGTGGG - Intergenic
1022317062 7:29255298-29255320 TCTGCCGGGATGGGGCTGGCTGG - Intronic
1023568944 7:41552868-41552890 TCTGCAAGGCAGCAGCTGGCAGG - Intergenic
1023852335 7:44157436-44157458 GCTGCCTCCCAGAGGCTGCCAGG - Intronic
1024453790 7:49579995-49580017 TCTCCTTGCCTGAGGCTGGCCGG - Intergenic
1025108027 7:56189157-56189179 GCTGCCTTGCAGAAGCTGGCTGG - Intergenic
1026310218 7:69176905-69176927 GCTGCCTTGCAGAAGCTGGCTGG + Intergenic
1026600398 7:71772934-71772956 AGTGCCTGGCAGATGCTTGCTGG + Intergenic
1027151009 7:75733640-75733662 GCTTCCTGGAGGAGGCTGGCAGG + Intronic
1029212964 7:98923724-98923746 TAAGCCTGGCAGGGGCTGGTGGG + Intronic
1029595821 7:101537217-101537239 TATTCCTGGGACAGGCTGGCAGG + Intronic
1032927509 7:136624523-136624545 TTTGCGAGGCAGAGGCAGGCAGG + Intergenic
1033741676 7:144280884-144280906 TCTGCCTTTCAGAGGCAGGGAGG - Intergenic
1033752225 7:144368730-144368752 TCTGCCTTTCAGAGGCAGGGAGG + Intronic
1034411847 7:150946154-150946176 TCTGGCTGCCAGAGGCGGCCTGG - Intronic
1034929322 7:155149025-155149047 TCTGCCTGGCAGAGCCTTCCAGG + Intergenic
1035218722 7:157391512-157391534 CCTGCTTGGCAGGGACTGGCAGG - Intronic
1035777015 8:2196084-2196106 CCGGCCATGCAGAGGCTGGCGGG - Intergenic
1035786313 8:2263889-2263911 TATGCCGGGCAGAGGCTGCAGGG - Intergenic
1035806494 8:2457827-2457849 TATGCCGGGCAGAGGCTGCAGGG + Intergenic
1036690736 8:10943252-10943274 TTTGCCTGGCAAAGGCTTACAGG - Intronic
1037837795 8:22224433-22224455 TCTGGCGGACAGAGGTTGGCCGG - Intronic
1038432984 8:27514760-27514782 TCTGCTTGGGAGACACTGGCCGG + Intronic
1039610930 8:38918907-38918929 TCTCACTGGCAGATCCTGGCTGG - Intronic
1040581485 8:48702160-48702182 ACTTCTTGGCAGAGGCTGGAAGG + Intergenic
1040956563 8:52985807-52985829 TCAGCATGGCAGAGGCTTGATGG - Intergenic
1041956843 8:63565761-63565783 TATTCCTGACGGAGGCTGGCAGG - Intergenic
1043578577 8:81686409-81686431 CCGGCCTGGCAGAGGCTCGCAGG - Intronic
1045244826 8:100433881-100433903 TCTCCCTGAGATAGGCTGGCTGG - Intergenic
1045545103 8:103121561-103121583 TCTCACTGGCACAGGCTGCCTGG - Intergenic
1047585587 8:126268712-126268734 GCTGGCTGGGAGAGGCTGGCTGG - Intergenic
1047965338 8:130042260-130042282 TCTGCTTGGCAGAGGCGGAAGGG + Intergenic
1049003147 8:139838689-139838711 TCCTCCTCCCAGAGGCTGGCAGG - Intronic
1049024066 8:139976725-139976747 GCAGCCTTGCAGAGTCTGGCAGG + Intronic
1049259168 8:141629581-141629603 ACTGCCACCCAGAGGCTGGCTGG - Intergenic
1049400455 8:142424455-142424477 TCTGGCTGCCGGGGGCTGGCTGG + Intergenic
1049422432 8:142522895-142522917 GCTGCCAGGGAGAAGCTGGCTGG - Intronic
1049809100 8:144555324-144555346 TCTGCCTGGCTTAGGCAGCCTGG - Intronic
1050671111 9:7997972-7997994 TCAGCCTTGCAGAGGTTTGCTGG + Intergenic
1050855816 9:10353512-10353534 TCTCCCATGCAGAGGTTGGCAGG - Intronic
1052860474 9:33435015-33435037 TCTGTTTGGGAGAGGCTGGGGGG - Intergenic
1057263488 9:93599120-93599142 TCTCCCTGGCAGAGGGTCCCTGG - Intronic
1057416724 9:94870399-94870421 TCTGTCTGGCAGATGCTGAGTGG + Intronic
1057744631 9:97741406-97741428 CCTGCCCGGCAGAGGCGGGCGGG - Intergenic
1058402543 9:104634924-104634946 TCTGTCTGGCTGAGTCTGGCTGG + Intergenic
1058879644 9:109275272-109275294 TCTGCATGTCAGGGGCTGGGTGG + Intronic
1059329449 9:113525660-113525682 TCTGGCTGGTTGGGGCTGGCAGG + Intronic
1059410759 9:114130849-114130871 TGTCCCTGGCAGAGACTGGAGGG - Intergenic
1060217909 9:121749371-121749393 TCTGCCTGTCATAGCCAGGCAGG - Intronic
1060601315 9:124880094-124880116 TGTTCCTGGCAGAGGCAGGTGGG + Exonic
1060789351 9:126475555-126475577 TCTGCTTAGCAGAGTCTTGCTGG + Intronic
1061003872 9:127917308-127917330 CCTGCCTGGGCGAGGCTGTCGGG + Intergenic
1061401399 9:130370316-130370338 CGTGCCAGGCAGAGGGTGGCTGG + Intronic
1061729621 9:132603743-132603765 TCGTCCCGGGAGAGGCTGGCTGG + Intronic
1061804214 9:133129091-133129113 TCTGCCGGGGAGGGGCTGGGTGG - Intronic
1061805309 9:133134422-133134444 TCTTTCTGGCAGAGGCTGTCTGG - Intronic
1061868658 9:133508333-133508355 GCTGCCTGGAAGAGGCAGGTTGG - Intergenic
1061931718 9:133836264-133836286 TCAGCCTGGCAGAGCCTCCCTGG - Intronic
1062039380 9:134397029-134397051 CCTGCCAGGCAGAGGCCGGAAGG + Intronic
1062171843 9:135139063-135139085 TTTGCATGGAAGAGGCAGGCGGG + Intergenic
1062181033 9:135191459-135191481 TCTGCCTGCCTGAGGGTCGCTGG + Intergenic
1062393425 9:136342952-136342974 TGGGCGTGGCAGAGGCTGGTGGG + Intronic
1062626947 9:137447708-137447730 GCAGCCTGGCACAGCCTGGCAGG - Exonic
1203746888 Un_GL000218v1:44975-44997 GCTGCCTGGCGGAGGCTGGATGG + Intergenic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1187268814 X:17761490-17761512 TCAGCCAGGTAGAGGCTGCCTGG - Intergenic
1187320662 X:18234836-18234858 TCAGCCAGGTAGAGGCTGCCTGG + Intergenic
1187759609 X:22566142-22566164 TCTGTCTCGCTGAGGCTGGGTGG - Intergenic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1189221149 X:39373272-39373294 ATTGACTGGCAGAGGCTGCCTGG + Intergenic
1189298496 X:39935788-39935810 TCTTCCTGGGAGGGCCTGGCTGG - Intergenic
1192164884 X:68821807-68821829 TATTCCTGGGAGAGACTGGCAGG + Intergenic
1192170202 X:68849704-68849726 TCTGGCTGCTAGAGTCTGGCTGG - Intergenic
1195667932 X:107447693-107447715 TCTGCCAGGGACAGTCTGGCTGG + Intergenic
1199654628 X:149982044-149982066 TCTGCATGGAAGAGGCTGGAAGG - Intergenic
1201160213 Y:11159989-11160011 GCTGCCTGGCGGAGGCTGGATGG + Intergenic