ID: 1063361434

View in Genome Browser
Species Human (GRCh38)
Location 10:5462746-5462768
Sequence CAGATCTATCAAGTTAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063361431_1063361434 6 Left 1063361431 10:5462717-5462739 CCTCTTTCACTGGGCAGGACAAG No data
Right 1063361434 10:5462746-5462768 CAGATCTATCAAGTTAGACCTGG No data
1063361427_1063361434 17 Left 1063361427 10:5462706-5462728 CCTTTTGTTTTCCTCTTTCACTG No data
Right 1063361434 10:5462746-5462768 CAGATCTATCAAGTTAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063361434 Original CRISPR CAGATCTATCAAGTTAGACC TGG Intergenic
No off target data available for this crispr