ID: 1063362376

View in Genome Browser
Species Human (GRCh38)
Location 10:5469001-5469023
Sequence CAGGGGAAACAGACCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063362366_1063362376 10 Left 1063362366 10:5468968-5468990 CCCCATCTTACTCAACCTTGCTT No data
Right 1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG No data
1063362365_1063362376 20 Left 1063362365 10:5468958-5468980 CCTTGAATGTCCCCATCTTACTC No data
Right 1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG No data
1063362371_1063362376 -5 Left 1063362371 10:5468983-5469005 CCTTGCTTCATTTCATGGCAGGG No data
Right 1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG No data
1063362367_1063362376 9 Left 1063362367 10:5468969-5468991 CCCATCTTACTCAACCTTGCTTC No data
Right 1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG No data
1063362368_1063362376 8 Left 1063362368 10:5468970-5468992 CCATCTTACTCAACCTTGCTTCA No data
Right 1063362376 10:5469001-5469023 CAGGGGAAACAGACCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063362376 Original CRISPR CAGGGGAAACAGACCCAGGA GGG Intergenic
No off target data available for this crispr