ID: 1063362658

View in Genome Browser
Species Human (GRCh38)
Location 10:5470351-5470373
Sequence GCTGCTGCTCTGTCACCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063362658_1063362668 25 Left 1063362658 10:5470351-5470373 CCTGGAGGTGACAGAGCAGCAGC No data
Right 1063362668 10:5470399-5470421 TTGGTGCTGCCTTACTTGGAAGG No data
1063362658_1063362661 -4 Left 1063362658 10:5470351-5470373 CCTGGAGGTGACAGAGCAGCAGC No data
Right 1063362661 10:5470370-5470392 CAGCATCTCTGGCCCTTCTAGGG No data
1063362658_1063362660 -5 Left 1063362658 10:5470351-5470373 CCTGGAGGTGACAGAGCAGCAGC No data
Right 1063362660 10:5470369-5470391 GCAGCATCTCTGGCCCTTCTAGG No data
1063362658_1063362667 21 Left 1063362658 10:5470351-5470373 CCTGGAGGTGACAGAGCAGCAGC No data
Right 1063362667 10:5470395-5470417 CTGCTTGGTGCTGCCTTACTTGG No data
1063362658_1063362662 6 Left 1063362658 10:5470351-5470373 CCTGGAGGTGACAGAGCAGCAGC No data
Right 1063362662 10:5470380-5470402 GGCCCTTCTAGGGCCCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063362658 Original CRISPR GCTGCTGCTCTGTCACCTCC AGG (reversed) Intergenic
No off target data available for this crispr