ID: 1063364204

View in Genome Browser
Species Human (GRCh38)
Location 10:5480028-5480050
Sequence ACCACAGCTGTCCCCTGCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063364197_1063364204 10 Left 1063364197 10:5479995-5480017 CCCCTGCCACTGTGTCTGCACCA No data
Right 1063364204 10:5480028-5480050 ACCACAGCTGTCCCCTGCCACGG No data
1063364198_1063364204 9 Left 1063364198 10:5479996-5480018 CCCTGCCACTGTGTCTGCACCAC No data
Right 1063364204 10:5480028-5480050 ACCACAGCTGTCCCCTGCCACGG No data
1063364196_1063364204 20 Left 1063364196 10:5479985-5480007 CCACGGCTGTCCCCTGCCACTGT No data
Right 1063364204 10:5480028-5480050 ACCACAGCTGTCCCCTGCCACGG No data
1063364199_1063364204 8 Left 1063364199 10:5479997-5480019 CCTGCCACTGTGTCTGCACCACA No data
Right 1063364204 10:5480028-5480050 ACCACAGCTGTCCCCTGCCACGG No data
1063364200_1063364204 4 Left 1063364200 10:5480001-5480023 CCACTGTGTCTGCACCACACTCC No data
Right 1063364204 10:5480028-5480050 ACCACAGCTGTCCCCTGCCACGG No data
1063364201_1063364204 -10 Left 1063364201 10:5480015-5480037 CCACACTCCACCAACCACAGCTG No data
Right 1063364204 10:5480028-5480050 ACCACAGCTGTCCCCTGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063364204 Original CRISPR ACCACAGCTGTCCCCTGCCA CGG Intergenic
No off target data available for this crispr