ID: 1063364328

View in Genome Browser
Species Human (GRCh38)
Location 10:5480662-5480684
Sequence CCCTCCAGGGAGGGGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063364328_1063364345 25 Left 1063364328 10:5480662-5480684 CCTGCCTTCCCCTCCCTGGAGGG No data
Right 1063364345 10:5480710-5480732 CACCCACCCTATCCAACCCTGGG No data
1063364328_1063364344 24 Left 1063364328 10:5480662-5480684 CCTGCCTTCCCCTCCCTGGAGGG No data
Right 1063364344 10:5480709-5480731 CCACCCACCCTATCCAACCCTGG No data
1063364328_1063364346 26 Left 1063364328 10:5480662-5480684 CCTGCCTTCCCCTCCCTGGAGGG No data
Right 1063364346 10:5480711-5480733 ACCCACCCTATCCAACCCTGGGG No data
1063364328_1063364349 29 Left 1063364328 10:5480662-5480684 CCTGCCTTCCCCTCCCTGGAGGG No data
Right 1063364349 10:5480714-5480736 CACCCTATCCAACCCTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063364328 Original CRISPR CCCTCCAGGGAGGGGAAGGC AGG (reversed) Intergenic
No off target data available for this crispr