ID: 1063365127

View in Genome Browser
Species Human (GRCh38)
Location 10:5486037-5486059
Sequence GCAGAGAGCCGGCCTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063365113_1063365127 23 Left 1063365113 10:5485991-5486013 CCAGTCCACTTGCTTCCCAGCAG No data
Right 1063365127 10:5486037-5486059 GCAGAGAGCCGGCCTGGGAAGGG No data
1063365120_1063365127 -6 Left 1063365120 10:5486020-5486042 CCCAGGTCCAAAGGCAGGCAGAG No data
Right 1063365127 10:5486037-5486059 GCAGAGAGCCGGCCTGGGAAGGG No data
1063365117_1063365127 7 Left 1063365117 10:5486007-5486029 CCAGCAGAAACATCCCAGGTCCA No data
Right 1063365127 10:5486037-5486059 GCAGAGAGCCGGCCTGGGAAGGG No data
1063365116_1063365127 8 Left 1063365116 10:5486006-5486028 CCCAGCAGAAACATCCCAGGTCC No data
Right 1063365127 10:5486037-5486059 GCAGAGAGCCGGCCTGGGAAGGG No data
1063365121_1063365127 -7 Left 1063365121 10:5486021-5486043 CCAGGTCCAAAGGCAGGCAGAGA No data
Right 1063365127 10:5486037-5486059 GCAGAGAGCCGGCCTGGGAAGGG No data
1063365114_1063365127 18 Left 1063365114 10:5485996-5486018 CCACTTGCTTCCCAGCAGAAACA No data
Right 1063365127 10:5486037-5486059 GCAGAGAGCCGGCCTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063365127 Original CRISPR GCAGAGAGCCGGCCTGGGAA GGG Intergenic
No off target data available for this crispr