ID: 1063365357

View in Genome Browser
Species Human (GRCh38)
Location 10:5487136-5487158
Sequence GATTAGGACAGGAGGGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063365357_1063365366 14 Left 1063365357 10:5487136-5487158 CCACCTTCCCTCCTGTCCTAATC No data
Right 1063365366 10:5487173-5487195 TGGCCGAATCTGCCTCCTACAGG No data
1063365357_1063365365 -6 Left 1063365357 10:5487136-5487158 CCACCTTCCCTCCTGTCCTAATC No data
Right 1063365365 10:5487153-5487175 CTAATCAGCTCAGGCTTAGGTGG No data
1063365357_1063365363 -9 Left 1063365357 10:5487136-5487158 CCACCTTCCCTCCTGTCCTAATC No data
Right 1063365363 10:5487150-5487172 GTCCTAATCAGCTCAGGCTTAGG No data
1063365357_1063365367 15 Left 1063365357 10:5487136-5487158 CCACCTTCCCTCCTGTCCTAATC No data
Right 1063365367 10:5487174-5487196 GGCCGAATCTGCCTCCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063365357 Original CRISPR GATTAGGACAGGAGGGAAGG TGG (reversed) Intergenic
No off target data available for this crispr