ID: 1063365363

View in Genome Browser
Species Human (GRCh38)
Location 10:5487150-5487172
Sequence GTCCTAATCAGCTCAGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063365357_1063365363 -9 Left 1063365357 10:5487136-5487158 CCACCTTCCCTCCTGTCCTAATC No data
Right 1063365363 10:5487150-5487172 GTCCTAATCAGCTCAGGCTTAGG No data
1063365352_1063365363 22 Left 1063365352 10:5487105-5487127 CCACGTCCCTTCCTTTCTCTGCT No data
Right 1063365363 10:5487150-5487172 GTCCTAATCAGCTCAGGCTTAGG No data
1063365350_1063365363 24 Left 1063365350 10:5487103-5487125 CCCCACGTCCCTTCCTTTCTCTG No data
Right 1063365363 10:5487150-5487172 GTCCTAATCAGCTCAGGCTTAGG No data
1063365348_1063365363 28 Left 1063365348 10:5487099-5487121 CCCTCCCCACGTCCCTTCCTTTC No data
Right 1063365363 10:5487150-5487172 GTCCTAATCAGCTCAGGCTTAGG No data
1063365351_1063365363 23 Left 1063365351 10:5487104-5487126 CCCACGTCCCTTCCTTTCTCTGC No data
Right 1063365363 10:5487150-5487172 GTCCTAATCAGCTCAGGCTTAGG No data
1063365356_1063365363 -6 Left 1063365356 10:5487133-5487155 CCTCCACCTTCCCTCCTGTCCTA No data
Right 1063365363 10:5487150-5487172 GTCCTAATCAGCTCAGGCTTAGG No data
1063365347_1063365363 29 Left 1063365347 10:5487098-5487120 CCCCTCCCCACGTCCCTTCCTTT No data
Right 1063365363 10:5487150-5487172 GTCCTAATCAGCTCAGGCTTAGG No data
1063365353_1063365363 16 Left 1063365353 10:5487111-5487133 CCCTTCCTTTCTCTGCTGACTGC No data
Right 1063365363 10:5487150-5487172 GTCCTAATCAGCTCAGGCTTAGG No data
1063365349_1063365363 27 Left 1063365349 10:5487100-5487122 CCTCCCCACGTCCCTTCCTTTCT No data
Right 1063365363 10:5487150-5487172 GTCCTAATCAGCTCAGGCTTAGG No data
1063365355_1063365363 11 Left 1063365355 10:5487116-5487138 CCTTTCTCTGCTGACTGCCTCCA No data
Right 1063365363 10:5487150-5487172 GTCCTAATCAGCTCAGGCTTAGG No data
1063365354_1063365363 15 Left 1063365354 10:5487112-5487134 CCTTCCTTTCTCTGCTGACTGCC No data
Right 1063365363 10:5487150-5487172 GTCCTAATCAGCTCAGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063365363 Original CRISPR GTCCTAATCAGCTCAGGCTT AGG Intergenic
No off target data available for this crispr