ID: 1063365365

View in Genome Browser
Species Human (GRCh38)
Location 10:5487153-5487175
Sequence CTAATCAGCTCAGGCTTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063365354_1063365365 18 Left 1063365354 10:5487112-5487134 CCTTCCTTTCTCTGCTGACTGCC No data
Right 1063365365 10:5487153-5487175 CTAATCAGCTCAGGCTTAGGTGG No data
1063365350_1063365365 27 Left 1063365350 10:5487103-5487125 CCCCACGTCCCTTCCTTTCTCTG No data
Right 1063365365 10:5487153-5487175 CTAATCAGCTCAGGCTTAGGTGG No data
1063365357_1063365365 -6 Left 1063365357 10:5487136-5487158 CCACCTTCCCTCCTGTCCTAATC No data
Right 1063365365 10:5487153-5487175 CTAATCAGCTCAGGCTTAGGTGG No data
1063365352_1063365365 25 Left 1063365352 10:5487105-5487127 CCACGTCCCTTCCTTTCTCTGCT No data
Right 1063365365 10:5487153-5487175 CTAATCAGCTCAGGCTTAGGTGG No data
1063365349_1063365365 30 Left 1063365349 10:5487100-5487122 CCTCCCCACGTCCCTTCCTTTCT No data
Right 1063365365 10:5487153-5487175 CTAATCAGCTCAGGCTTAGGTGG No data
1063365351_1063365365 26 Left 1063365351 10:5487104-5487126 CCCACGTCCCTTCCTTTCTCTGC No data
Right 1063365365 10:5487153-5487175 CTAATCAGCTCAGGCTTAGGTGG No data
1063365358_1063365365 -9 Left 1063365358 10:5487139-5487161 CCTTCCCTCCTGTCCTAATCAGC No data
Right 1063365365 10:5487153-5487175 CTAATCAGCTCAGGCTTAGGTGG No data
1063365355_1063365365 14 Left 1063365355 10:5487116-5487138 CCTTTCTCTGCTGACTGCCTCCA No data
Right 1063365365 10:5487153-5487175 CTAATCAGCTCAGGCTTAGGTGG No data
1063365356_1063365365 -3 Left 1063365356 10:5487133-5487155 CCTCCACCTTCCCTCCTGTCCTA No data
Right 1063365365 10:5487153-5487175 CTAATCAGCTCAGGCTTAGGTGG No data
1063365353_1063365365 19 Left 1063365353 10:5487111-5487133 CCCTTCCTTTCTCTGCTGACTGC No data
Right 1063365365 10:5487153-5487175 CTAATCAGCTCAGGCTTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063365365 Original CRISPR CTAATCAGCTCAGGCTTAGG TGG Intergenic
No off target data available for this crispr