ID: 1063365367

View in Genome Browser
Species Human (GRCh38)
Location 10:5487174-5487196
Sequence GGCCGAATCTGCCTCCTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063365357_1063365367 15 Left 1063365357 10:5487136-5487158 CCACCTTCCCTCCTGTCCTAATC No data
Right 1063365367 10:5487174-5487196 GGCCGAATCTGCCTCCTACAGGG No data
1063365358_1063365367 12 Left 1063365358 10:5487139-5487161 CCTTCCCTCCTGTCCTAATCAGC No data
Right 1063365367 10:5487174-5487196 GGCCGAATCTGCCTCCTACAGGG No data
1063365364_1063365367 -1 Left 1063365364 10:5487152-5487174 CCTAATCAGCTCAGGCTTAGGTG No data
Right 1063365367 10:5487174-5487196 GGCCGAATCTGCCTCCTACAGGG No data
1063365360_1063365367 7 Left 1063365360 10:5487144-5487166 CCTCCTGTCCTAATCAGCTCAGG No data
Right 1063365367 10:5487174-5487196 GGCCGAATCTGCCTCCTACAGGG No data
1063365359_1063365367 8 Left 1063365359 10:5487143-5487165 CCCTCCTGTCCTAATCAGCTCAG No data
Right 1063365367 10:5487174-5487196 GGCCGAATCTGCCTCCTACAGGG No data
1063365362_1063365367 4 Left 1063365362 10:5487147-5487169 CCTGTCCTAATCAGCTCAGGCTT No data
Right 1063365367 10:5487174-5487196 GGCCGAATCTGCCTCCTACAGGG No data
1063365356_1063365367 18 Left 1063365356 10:5487133-5487155 CCTCCACCTTCCCTCCTGTCCTA No data
Right 1063365367 10:5487174-5487196 GGCCGAATCTGCCTCCTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063365367 Original CRISPR GGCCGAATCTGCCTCCTACA GGG Intergenic
No off target data available for this crispr