ID: 1063366276

View in Genome Browser
Species Human (GRCh38)
Location 10:5492911-5492933
Sequence TCAGGGGGTCCTTGACTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063366276_1063366283 11 Left 1063366276 10:5492911-5492933 CCAAGAAGTCAAGGACCCCCTGA No data
Right 1063366283 10:5492945-5492967 CAGCGCAAGCCAGCGGCTCTTGG No data
1063366276_1063366282 4 Left 1063366276 10:5492911-5492933 CCAAGAAGTCAAGGACCCCCTGA No data
Right 1063366282 10:5492938-5492960 GAAGCTTCAGCGCAAGCCAGCGG No data
1063366276_1063366285 22 Left 1063366276 10:5492911-5492933 CCAAGAAGTCAAGGACCCCCTGA No data
Right 1063366285 10:5492956-5492978 AGCGGCTCTTGGTGTGTGTGTGG No data
1063366276_1063366287 28 Left 1063366276 10:5492911-5492933 CCAAGAAGTCAAGGACCCCCTGA No data
Right 1063366287 10:5492962-5492984 TCTTGGTGTGTGTGTGGAGTGGG No data
1063366276_1063366286 27 Left 1063366276 10:5492911-5492933 CCAAGAAGTCAAGGACCCCCTGA No data
Right 1063366286 10:5492961-5492983 CTCTTGGTGTGTGTGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063366276 Original CRISPR TCAGGGGGTCCTTGACTTCT TGG (reversed) Intergenic
No off target data available for this crispr