ID: 1063366278

View in Genome Browser
Species Human (GRCh38)
Location 10:5492926-5492948
Sequence GCTGAAGCTTCCTTGTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063366278_1063366286 12 Left 1063366278 10:5492926-5492948 CCCCCTGACAAGGAAGCTTCAGC No data
Right 1063366286 10:5492961-5492983 CTCTTGGTGTGTGTGTGGAGTGG No data
1063366278_1063366283 -4 Left 1063366278 10:5492926-5492948 CCCCCTGACAAGGAAGCTTCAGC No data
Right 1063366283 10:5492945-5492967 CAGCGCAAGCCAGCGGCTCTTGG No data
1063366278_1063366285 7 Left 1063366278 10:5492926-5492948 CCCCCTGACAAGGAAGCTTCAGC No data
Right 1063366285 10:5492956-5492978 AGCGGCTCTTGGTGTGTGTGTGG No data
1063366278_1063366287 13 Left 1063366278 10:5492926-5492948 CCCCCTGACAAGGAAGCTTCAGC No data
Right 1063366287 10:5492962-5492984 TCTTGGTGTGTGTGTGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063366278 Original CRISPR GCTGAAGCTTCCTTGTCAGG GGG (reversed) Intergenic