ID: 1063366280

View in Genome Browser
Species Human (GRCh38)
Location 10:5492928-5492950
Sequence GCGCTGAAGCTTCCTTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063366280_1063366286 10 Left 1063366280 10:5492928-5492950 CCCTGACAAGGAAGCTTCAGCGC No data
Right 1063366286 10:5492961-5492983 CTCTTGGTGTGTGTGTGGAGTGG No data
1063366280_1063366287 11 Left 1063366280 10:5492928-5492950 CCCTGACAAGGAAGCTTCAGCGC No data
Right 1063366287 10:5492962-5492984 TCTTGGTGTGTGTGTGGAGTGGG No data
1063366280_1063366283 -6 Left 1063366280 10:5492928-5492950 CCCTGACAAGGAAGCTTCAGCGC No data
Right 1063366283 10:5492945-5492967 CAGCGCAAGCCAGCGGCTCTTGG No data
1063366280_1063366285 5 Left 1063366280 10:5492928-5492950 CCCTGACAAGGAAGCTTCAGCGC No data
Right 1063366285 10:5492956-5492978 AGCGGCTCTTGGTGTGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063366280 Original CRISPR GCGCTGAAGCTTCCTTGTCA GGG (reversed) Intergenic
No off target data available for this crispr