ID: 1063366283

View in Genome Browser
Species Human (GRCh38)
Location 10:5492945-5492967
Sequence CAGCGCAAGCCAGCGGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063366281_1063366283 -7 Left 1063366281 10:5492929-5492951 CCTGACAAGGAAGCTTCAGCGCA No data
Right 1063366283 10:5492945-5492967 CAGCGCAAGCCAGCGGCTCTTGG No data
1063366280_1063366283 -6 Left 1063366280 10:5492928-5492950 CCCTGACAAGGAAGCTTCAGCGC No data
Right 1063366283 10:5492945-5492967 CAGCGCAAGCCAGCGGCTCTTGG No data
1063366278_1063366283 -4 Left 1063366278 10:5492926-5492948 CCCCCTGACAAGGAAGCTTCAGC No data
Right 1063366283 10:5492945-5492967 CAGCGCAAGCCAGCGGCTCTTGG No data
1063366279_1063366283 -5 Left 1063366279 10:5492927-5492949 CCCCTGACAAGGAAGCTTCAGCG No data
Right 1063366283 10:5492945-5492967 CAGCGCAAGCCAGCGGCTCTTGG No data
1063366276_1063366283 11 Left 1063366276 10:5492911-5492933 CCAAGAAGTCAAGGACCCCCTGA No data
Right 1063366283 10:5492945-5492967 CAGCGCAAGCCAGCGGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063366283 Original CRISPR CAGCGCAAGCCAGCGGCTCT TGG Intergenic
No off target data available for this crispr