ID: 1063366324

View in Genome Browser
Species Human (GRCh38)
Location 10:5493144-5493166
Sequence GCCTCCATGCAGAGCCGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063366315_1063366324 16 Left 1063366315 10:5493105-5493127 CCCCTGTGCCTGCCCAAACTGTG No data
Right 1063366324 10:5493144-5493166 GCCTCCATGCAGAGCCGGGAAGG No data
1063366311_1063366324 28 Left 1063366311 10:5493093-5493115 CCCTCTCCTGTCCCCCTGTGCCT No data
Right 1063366324 10:5493144-5493166 GCCTCCATGCAGAGCCGGGAAGG No data
1063366316_1063366324 15 Left 1063366316 10:5493106-5493128 CCCTGTGCCTGCCCAAACTGTGC No data
Right 1063366324 10:5493144-5493166 GCCTCCATGCAGAGCCGGGAAGG No data
1063366314_1063366324 17 Left 1063366314 10:5493104-5493126 CCCCCTGTGCCTGCCCAAACTGT No data
Right 1063366324 10:5493144-5493166 GCCTCCATGCAGAGCCGGGAAGG No data
1063366321_1063366324 3 Left 1063366321 10:5493118-5493140 CCAAACTGTGCGCTGATATTGGT No data
Right 1063366324 10:5493144-5493166 GCCTCCATGCAGAGCCGGGAAGG No data
1063366317_1063366324 14 Left 1063366317 10:5493107-5493129 CCTGTGCCTGCCCAAACTGTGCG No data
Right 1063366324 10:5493144-5493166 GCCTCCATGCAGAGCCGGGAAGG No data
1063366312_1063366324 27 Left 1063366312 10:5493094-5493116 CCTCTCCTGTCCCCCTGTGCCTG No data
Right 1063366324 10:5493144-5493166 GCCTCCATGCAGAGCCGGGAAGG No data
1063366313_1063366324 22 Left 1063366313 10:5493099-5493121 CCTGTCCCCCTGTGCCTGCCCAA No data
Right 1063366324 10:5493144-5493166 GCCTCCATGCAGAGCCGGGAAGG No data
1063366319_1063366324 4 Left 1063366319 10:5493117-5493139 CCCAAACTGTGCGCTGATATTGG No data
Right 1063366324 10:5493144-5493166 GCCTCCATGCAGAGCCGGGAAGG No data
1063366318_1063366324 8 Left 1063366318 10:5493113-5493135 CCTGCCCAAACTGTGCGCTGATA No data
Right 1063366324 10:5493144-5493166 GCCTCCATGCAGAGCCGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063366324 Original CRISPR GCCTCCATGCAGAGCCGGGA AGG Intergenic
No off target data available for this crispr