ID: 1063367190

View in Genome Browser
Species Human (GRCh38)
Location 10:5498684-5498706
Sequence CACCAAGCACACATGGAACT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 138}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063367179_1063367190 21 Left 1063367179 10:5498640-5498662 CCCTGGAAGCAGGTGGGGGCCCT 0: 1
1: 0
2: 3
3: 27
4: 315
Right 1063367190 10:5498684-5498706 CACCAAGCACACATGGAACTCGG 0: 1
1: 0
2: 2
3: 10
4: 138
1063367183_1063367190 2 Left 1063367183 10:5498659-5498681 CCCTCGGAGGCAGCCGCCCCACA 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1063367190 10:5498684-5498706 CACCAAGCACACATGGAACTCGG 0: 1
1: 0
2: 2
3: 10
4: 138
1063367180_1063367190 20 Left 1063367180 10:5498641-5498663 CCTGGAAGCAGGTGGGGGCCCTC 0: 1
1: 0
2: 1
3: 35
4: 407
Right 1063367190 10:5498684-5498706 CACCAAGCACACATGGAACTCGG 0: 1
1: 0
2: 2
3: 10
4: 138
1063367184_1063367190 1 Left 1063367184 10:5498660-5498682 CCTCGGAGGCAGCCGCCCCACAA 0: 1
1: 0
2: 0
3: 3
4: 96
Right 1063367190 10:5498684-5498706 CACCAAGCACACATGGAACTCGG 0: 1
1: 0
2: 2
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063367190 Original CRISPR CACCAAGCACACATGGAACT CGG Exonic
900952808 1:5867470-5867492 CTCCAGGCACACCTGGACCTGGG + Intronic
902966745 1:20010510-20010532 CAGCATGAACCCATGGAACTTGG - Intergenic
903040619 1:20527216-20527238 CCTCAAGCACACATGGACCCAGG + Intergenic
903582293 1:24380651-24380673 CACCAAGCACAGAGTGAAGTAGG - Intronic
906381022 1:45332242-45332264 AACCAAGCAGCCATGGAGCTAGG - Exonic
906946611 1:50300182-50300204 CACCAGGCAGAGATGGAACAGGG + Intergenic
909300816 1:74011014-74011036 CACCAGGCTCAAATGGAAGTAGG + Intergenic
912384420 1:109264174-109264196 CACCATGCACAGCTGGCACTGGG + Exonic
912590411 1:110813251-110813273 GGACAAGCACACATGGAACTGGG + Intergenic
916756237 1:167772635-167772657 TACCAAACACACTTGGAGCTGGG + Intronic
917233705 1:172866351-172866373 CACGAAGCCCAGATGGAGCTGGG + Intergenic
917494426 1:175527139-175527161 AACCAAGCAGACATGGAAGGTGG - Intronic
919157440 1:193784967-193784989 CACCAAGCACACAGAGAACCTGG + Intergenic
924761886 1:246995029-246995051 CAACAAGTACACAGGGAACGGGG + Intronic
1063136216 10:3218728-3218750 CACAGAGAGCACATGGAACTTGG - Intergenic
1063367190 10:5498684-5498706 CACCAAGCACACATGGAACTCGG + Exonic
1063585356 10:7347303-7347325 CACCATGCAGACATGGAATTTGG + Intronic
1064007903 10:11712905-11712927 CTCCAAGAACACGTGGAACAAGG + Intergenic
1065160473 10:22915830-22915852 CTGCAATTACACATGGAACTTGG + Intergenic
1066474442 10:35731345-35731367 CACCAAGCTCAGATGGACATTGG - Intergenic
1067260427 10:44685078-44685100 CAGCATGCCCACATGGAACCAGG + Intergenic
1068139282 10:52984337-52984359 CTCCAAGAACACATGTAGCTAGG - Intergenic
1071693790 10:87850969-87850991 CACCAAACCCACATGGAGCAAGG - Intergenic
1072666056 10:97393286-97393308 CACTGAGCACACATGGAACCAGG + Intronic
1073550265 10:104393609-104393631 AACCAAGCACACAAGGCACCAGG + Intronic
1076303730 10:129448139-129448161 CACTTAGCACACATGGATCCTGG + Intergenic
1078587782 11:12608957-12608979 CACCAAGAACACATGGACACAGG + Intergenic
1078930506 11:15908811-15908833 CACCAAGCCCCTATGGCACTGGG - Intergenic
1078974559 11:16457627-16457649 CAGCAAGAACAAATGGACCTTGG - Intronic
1088063692 11:105689190-105689212 CACCAAGAAGAGATGGAATTTGG + Intronic
1088592784 11:111417577-111417599 CACCCAGCACCCAAGGAATTAGG - Intronic
1089735565 11:120548254-120548276 CACTAAGCATCCATGGCACTGGG - Intronic
1091330968 11:134730565-134730587 CACCCAGCACACCTGGAAAGAGG - Intergenic
1095753768 12:45739353-45739375 AGCCAAGCACACCTGGAACATGG - Intronic
1098888045 12:75980203-75980225 CATCAAGCACACATAGAAAGGGG + Intergenic
1101700499 12:107169372-107169394 CTCCAGGCACACAGGGAATTTGG + Intergenic
1103034268 12:117643693-117643715 TAACAAGCACTCATGGAATTAGG - Intronic
1106085499 13:26538306-26538328 CATCAAGCACACATGTACCAAGG - Intergenic
1110715626 13:78700699-78700721 CAACAAGTACTAATGGAACTTGG + Intergenic
1113871150 13:113560637-113560659 CACCAGGAACACAGGAAACTAGG - Intergenic
1116698312 14:48203746-48203768 CACCAAGAACACATGGACACAGG + Intergenic
1117214202 14:53533360-53533382 CACAAAGTAGACTTGGAACTAGG + Intergenic
1119782629 14:77287681-77287703 AACAAAGCACACAAGGAAATAGG - Intronic
1131995740 15:98131245-98131267 CAACAATCCCACATGGAAGTTGG + Intergenic
1133048289 16:3101334-3101356 CGCCAAGGACACATGCAGCTGGG - Intergenic
1137385012 16:48033429-48033451 GAGGAGGCACACATGGAACTGGG - Intergenic
1137730681 16:50687387-50687409 CAGGACGGACACATGGAACTTGG + Intergenic
1141829819 16:86503996-86504018 CACTTAGCACAGATGGGACTGGG - Intergenic
1142039256 16:87882071-87882093 CCCCAAGCCCACCTGGAAATGGG + Exonic
1142631100 17:1227363-1227385 CACCAAGGGCATTTGGAACTTGG + Intronic
1142649034 17:1334540-1334562 CACCAAGAACACACTGGACTCGG + Intergenic
1142883134 17:2896486-2896508 CCCCAGGCTCACATAGAACTCGG + Intronic
1144152793 17:12466620-12466642 CACCTATCACACAAAGAACTAGG - Intergenic
1144578179 17:16443064-16443086 CCCCTAGCATAGATGGAACTGGG + Intronic
1145201726 17:20951561-20951583 CACCAAGCAGAGAAGAAACTGGG - Intergenic
1146453082 17:32990331-32990353 CACCAACCTCACAGGGTACTAGG - Intronic
1147842716 17:43383377-43383399 AAGCAAGCACATATGAAACTAGG + Intergenic
1148981985 17:51584725-51584747 CACTAACCACACATGGCAATTGG - Intergenic
1203166506 17_GL000205v2_random:101980-102002 CACTGAGCACACACGGCACTGGG + Intergenic
1153646202 18:7198252-7198274 CAACACGCAGACATGGAACTGGG + Intergenic
1157038162 18:44002415-44002437 CAACAAACAAACATTGAACTTGG + Intergenic
1163041826 19:14608388-14608410 TGCCAAGCACACAGGGAAATGGG - Intronic
1163894026 19:20041422-20041444 CACTGAGCACACATGGAACCAGG - Intergenic
1165613686 19:37179407-37179429 CACCACCCGCACATGGAATTAGG + Intronic
1167080994 19:47275898-47275920 CTCCAAGCACACAAAAAACTGGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
925437876 2:3856978-3857000 CTCAAAGCACACATGGGGCTTGG - Intergenic
928479379 2:31666557-31666579 CTCCAAGAACACAGTGAACTTGG - Intergenic
930553207 2:52861808-52861830 CATCAAGCAGCCATGGACCTGGG - Intergenic
932245316 2:70191739-70191761 CACCATGAACACATTGCACTCGG - Intronic
933306560 2:80607424-80607446 CATCAAGCACACACAGAGCTTGG - Intronic
933985529 2:87589024-87589046 CACTGAGAACACATGGAACCAGG + Intergenic
936667321 2:114611154-114611176 CACCAAGCAGAAATGGGAATCGG + Intronic
939194743 2:138957962-138957984 CACCAAGCACAATTCTAACTTGG + Intergenic
948947091 2:241226216-241226238 CACCAAGCAGAGATGGAACTGGG + Intergenic
1169824307 20:9749858-9749880 CAGCAAGGAGATATGGAACTTGG - Intronic
1170153369 20:13248045-13248067 CACATAGCCCACCTGGAACTTGG - Intronic
1172470909 20:35194626-35194648 TACCAAGCACATGTGCAACTTGG - Intergenic
1173978793 20:47207254-47207276 CACCCAGCTCACATTCAACTGGG + Intergenic
1174158845 20:48535935-48535957 CACAAACCAAACATGGCACTCGG + Intergenic
1174322416 20:49752394-49752416 CACCCAGCACACATGGTATTTGG - Intergenic
1176335029 21:5588565-5588587 CACTGAGCACACACGGCACTGGG - Intergenic
1176392728 21:6232383-6232405 CACTGAGCACACACGGCACTGGG + Intergenic
1176405249 21:6357116-6357138 CACTGAGCACACACGGCACTGGG - Intergenic
1176431908 21:6631987-6632009 CACTGAGCACACACGGCACTGGG + Intergenic
1176468691 21:7083791-7083813 CACTGAGCACACACGGCACTGGG - Intronic
1176492252 21:7465569-7465591 CACTGAGCACACACGGCACTGGG - Intergenic
1176508390 21:7672814-7672836 CACTGAGCACACACGGCACTGGG + Intergenic
1176878657 21:14164775-14164797 CACCAAGTAGACATGAAACATGG - Intronic
1178832448 21:36067915-36067937 CACAAAGTACACATCAAACTGGG + Intronic
1178937616 21:36876693-36876715 TACCAAGCACACTTGAAACAAGG + Intronic
1181037168 22:20175261-20175283 GACCAAGCACACAAGAGACTGGG + Intergenic
949876008 3:8626510-8626532 CACCCAGCCCACATGGCTCTAGG + Intronic
950505176 3:13390142-13390164 CACCATGCAGTCATGGCACTAGG - Intronic
952394591 3:32909925-32909947 GACCAAGCACACAAAGAAATAGG - Intergenic
952943450 3:38460117-38460139 CCCCAAAAACAGATGGAACTAGG - Intronic
953330632 3:42050247-42050269 CACCAGGCACAAATGAAAGTAGG - Intronic
954971498 3:54655043-54655065 CACCAAGCACACGTTGGATTGGG - Intronic
958655148 3:96991824-96991846 CACACAACACACATGGAACAGGG + Intronic
961345559 3:126261081-126261103 CATCAGCCACACATTGAACTGGG - Intergenic
963552954 3:146747728-146747750 CACCAAACACAGATGGAAACTGG - Intergenic
967971471 3:195002755-195002777 AACAAAGAACAAATGGAACTTGG - Intergenic
968479804 4:828056-828078 CTCCAAGCACACCTGGAGCTGGG + Intergenic
968725518 4:2246144-2246166 CACCAATCATACATGGAACTGGG + Intergenic
973219712 4:47711350-47711372 CACCTATCACAAAGGGAACTGGG - Intronic
973729519 4:53810309-53810331 CACCAATCTGAAATGGAACTTGG + Intronic
974021044 4:56692771-56692793 CGCCAAGCACACAAGGACCATGG + Intergenic
978449649 4:108818224-108818246 TACCAAGCAAACAAAGAACTGGG + Intronic
981410194 4:144420727-144420749 CACCAAGGACACATGGATACCGG - Intergenic
983868845 4:172801594-172801616 CACAAGGCACACAGGGCACTAGG + Intronic
987946648 5:24618048-24618070 AACCAAACACACATTGAAATTGG - Intronic
992857427 5:80877102-80877124 CAAAAAGAACACATGGATCTGGG - Intergenic
994553778 5:101270971-101270993 CCCCAAGCTCACGTGGGACTGGG + Intergenic
996759174 5:126969918-126969940 GACCAAGCAAACATGAAGCTAGG + Intronic
998506090 5:142674058-142674080 CACCAGGCACACATGAAGCAGGG - Intronic
998603401 5:143608075-143608097 CTCCCATGACACATGGAACTGGG - Intergenic
1003530427 6:6932865-6932887 TACCAACGACACAAGGAACTAGG + Intergenic
1004756150 6:18612753-18612775 CACCAAACACATAAGGAAGTGGG - Intergenic
1006867465 6:37220770-37220792 AACCAAGCACATAAGGAACAAGG + Intronic
1007890082 6:45281264-45281286 CACCAAGCATAAATCGAAGTAGG + Intronic
1018739735 6:166718224-166718246 CTCCAGGCACAAAGGGAACTAGG + Intronic
1021650329 7:22826803-22826825 CACATAGCACACATGGCACATGG + Intergenic
1023135136 7:37043791-37043813 AGCCCAGCACACAAGGAACTGGG + Intronic
1028871927 7:95779850-95779872 TACCAAGCACACATTCATCTTGG - Intronic
1030472041 7:109976933-109976955 TAACAAGCACACATGGAATTTGG - Intergenic
1032304867 7:130723106-130723128 CACCAAGGCCACAGGGAACTGGG - Intergenic
1033549274 7:142431814-142431836 CAGTAAGAACAGATGGAACTGGG + Intergenic
1035009694 7:155703131-155703153 CACTAAGCACACATGCAAGCTGG - Intronic
1037170113 8:15881360-15881382 AACCAAGCACACATTGTGCTAGG + Intergenic
1037581126 8:20246638-20246660 CACTGAGCTCACATGGGACTGGG - Exonic
1037959855 8:23088477-23088499 CACGCACCACACATGGAACCAGG + Intronic
1038706385 8:29897875-29897897 CACCAAGTACTCCAGGAACTTGG + Intergenic
1039665037 8:39517017-39517039 CTCCAAACACAGATGGGACTTGG - Intergenic
1040810033 8:51441430-51441452 GACCAAGCAGACATCTAACTAGG - Intronic
1044467239 8:92521810-92521832 CACCAATCACACATGAAATGTGG + Intergenic
1045411589 8:101926029-101926051 CACCAAAGCCACATGGAGCTGGG - Intronic
1046360524 8:113147956-113147978 GACCAAGAATACAGGGAACTAGG - Intronic
1046803246 8:118451827-118451849 CACCAAGAAATCATGGACCTGGG - Intronic
1048328403 8:133455844-133455866 CACAAAGAACATTTGGAACTGGG - Exonic
1048804687 8:138229070-138229092 CACCACACTCACATGGAAATCGG + Intronic
1049609030 8:143544279-143544301 CACCTAGCCCAGATGGATCTAGG + Intergenic
1055133409 9:72801743-72801765 TGACAAGCACACAAGGAACTAGG + Intronic
1058504330 9:105653280-105653302 CTCCCAGCCCACATGGACCTAGG - Intergenic
1203426611 Un_GL000195v1:46351-46373 CACTGAGCACACACGGCACTGGG + Intergenic
1203439631 Un_GL000195v1:176721-176743 CACTGAGCACACACGGCACTGGG - Intergenic
1186781799 X:12919829-12919851 CACAAGGCACGCATGGAAATGGG - Exonic
1188120664 X:26303239-26303261 GACCTAGGACACATTGAACTTGG - Intergenic
1189137988 X:38569571-38569593 CTCCATGCACACCTGGAAGTAGG - Intronic
1192857710 X:75031432-75031454 CAACAAGAACACATGGACCAGGG - Intergenic
1196888594 X:120270856-120270878 CACCAACCACACTTGGATGTAGG + Intronic
1197984826 X:132256265-132256287 CACCAAGCAGAAAGGGACCTGGG - Intergenic