ID: 1063367936

View in Genome Browser
Species Human (GRCh38)
Location 10:5502638-5502660
Sequence CGTGTATCCCTGTGTGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063367932_1063367936 20 Left 1063367932 10:5502595-5502617 CCCTTCTTTCTAGCTAAGGTGCA No data
Right 1063367936 10:5502638-5502660 CGTGTATCCCTGTGTGATGCAGG No data
1063367933_1063367936 19 Left 1063367933 10:5502596-5502618 CCTTCTTTCTAGCTAAGGTGCAT No data
Right 1063367936 10:5502638-5502660 CGTGTATCCCTGTGTGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063367936 Original CRISPR CGTGTATCCCTGTGTGATGC AGG Intergenic
No off target data available for this crispr