ID: 1063368513

View in Genome Browser
Species Human (GRCh38)
Location 10:5506520-5506542
Sequence TCTCCAGCTCTCCCTGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063368513_1063368523 24 Left 1063368513 10:5506520-5506542 CCCATCCCAGGGAGAGCTGGAGA No data
Right 1063368523 10:5506567-5506589 TCTGGTTGCATCCACTGTACAGG No data
1063368513_1063368520 6 Left 1063368513 10:5506520-5506542 CCCATCCCAGGGAGAGCTGGAGA No data
Right 1063368520 10:5506549-5506571 GGCCCTCGGCTTAGGAGCTCTGG No data
1063368513_1063368519 -2 Left 1063368513 10:5506520-5506542 CCCATCCCAGGGAGAGCTGGAGA No data
Right 1063368519 10:5506541-5506563 GACAAGAAGGCCCTCGGCTTAGG No data
1063368513_1063368518 -8 Left 1063368513 10:5506520-5506542 CCCATCCCAGGGAGAGCTGGAGA No data
Right 1063368518 10:5506535-5506557 GCTGGAGACAAGAAGGCCCTCGG No data
1063368513_1063368524 27 Left 1063368513 10:5506520-5506542 CCCATCCCAGGGAGAGCTGGAGA No data
Right 1063368524 10:5506570-5506592 GGTTGCATCCACTGTACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063368513 Original CRISPR TCTCCAGCTCTCCCTGGGAT GGG (reversed) Intergenic