ID: 1063368515

View in Genome Browser
Species Human (GRCh38)
Location 10:5506525-5506547
Sequence TCTTGTCTCCAGCTCTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063368515_1063368519 -7 Left 1063368515 10:5506525-5506547 CCCAGGGAGAGCTGGAGACAAGA No data
Right 1063368519 10:5506541-5506563 GACAAGAAGGCCCTCGGCTTAGG No data
1063368515_1063368523 19 Left 1063368515 10:5506525-5506547 CCCAGGGAGAGCTGGAGACAAGA No data
Right 1063368523 10:5506567-5506589 TCTGGTTGCATCCACTGTACAGG No data
1063368515_1063368525 27 Left 1063368515 10:5506525-5506547 CCCAGGGAGAGCTGGAGACAAGA No data
Right 1063368525 10:5506575-5506597 CATCCACTGTACAGGAGGTTAGG No data
1063368515_1063368524 22 Left 1063368515 10:5506525-5506547 CCCAGGGAGAGCTGGAGACAAGA No data
Right 1063368524 10:5506570-5506592 GGTTGCATCCACTGTACAGGAGG No data
1063368515_1063368520 1 Left 1063368515 10:5506525-5506547 CCCAGGGAGAGCTGGAGACAAGA No data
Right 1063368520 10:5506549-5506571 GGCCCTCGGCTTAGGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063368515 Original CRISPR TCTTGTCTCCAGCTCTCCCT GGG (reversed) Intergenic