ID: 1063368516

View in Genome Browser
Species Human (GRCh38)
Location 10:5506526-5506548
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063368516_1063368525 26 Left 1063368516 10:5506526-5506548 CCAGGGAGAGCTGGAGACAAGAA No data
Right 1063368525 10:5506575-5506597 CATCCACTGTACAGGAGGTTAGG No data
1063368516_1063368524 21 Left 1063368516 10:5506526-5506548 CCAGGGAGAGCTGGAGACAAGAA No data
Right 1063368524 10:5506570-5506592 GGTTGCATCCACTGTACAGGAGG No data
1063368516_1063368519 -8 Left 1063368516 10:5506526-5506548 CCAGGGAGAGCTGGAGACAAGAA No data
Right 1063368519 10:5506541-5506563 GACAAGAAGGCCCTCGGCTTAGG No data
1063368516_1063368520 0 Left 1063368516 10:5506526-5506548 CCAGGGAGAGCTGGAGACAAGAA No data
Right 1063368520 10:5506549-5506571 GGCCCTCGGCTTAGGAGCTCTGG No data
1063368516_1063368523 18 Left 1063368516 10:5506526-5506548 CCAGGGAGAGCTGGAGACAAGAA No data
Right 1063368523 10:5506567-5506589 TCTGGTTGCATCCACTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063368516 Original CRISPR TTCTTGTCTCCAGCTCTCCC TGG (reversed) Intergenic