ID: 1063368521

View in Genome Browser
Species Human (GRCh38)
Location 10:5506551-5506573
Sequence AACCAGAGCTCCTAAGCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063368521_1063368525 1 Left 1063368521 10:5506551-5506573 CCCTCGGCTTAGGAGCTCTGGTT No data
Right 1063368525 10:5506575-5506597 CATCCACTGTACAGGAGGTTAGG No data
1063368521_1063368524 -4 Left 1063368521 10:5506551-5506573 CCCTCGGCTTAGGAGCTCTGGTT No data
Right 1063368524 10:5506570-5506592 GGTTGCATCCACTGTACAGGAGG No data
1063368521_1063368523 -7 Left 1063368521 10:5506551-5506573 CCCTCGGCTTAGGAGCTCTGGTT No data
Right 1063368523 10:5506567-5506589 TCTGGTTGCATCCACTGTACAGG No data
1063368521_1063368530 27 Left 1063368521 10:5506551-5506573 CCCTCGGCTTAGGAGCTCTGGTT No data
Right 1063368530 10:5506601-5506623 CCCTACCTCTTCCTGCTATGGGG No data
1063368521_1063368527 25 Left 1063368521 10:5506551-5506573 CCCTCGGCTTAGGAGCTCTGGTT No data
Right 1063368527 10:5506599-5506621 ATCCCTACCTCTTCCTGCTATGG No data
1063368521_1063368528 26 Left 1063368521 10:5506551-5506573 CCCTCGGCTTAGGAGCTCTGGTT No data
Right 1063368528 10:5506600-5506622 TCCCTACCTCTTCCTGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063368521 Original CRISPR AACCAGAGCTCCTAAGCCGA GGG (reversed) Intergenic