ID: 1063368523

View in Genome Browser
Species Human (GRCh38)
Location 10:5506567-5506589
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063368515_1063368523 19 Left 1063368515 10:5506525-5506547 CCCAGGGAGAGCTGGAGACAAGA No data
Right 1063368523 10:5506567-5506589 TCTGGTTGCATCCACTGTACAGG No data
1063368522_1063368523 -8 Left 1063368522 10:5506552-5506574 CCTCGGCTTAGGAGCTCTGGTTG No data
Right 1063368523 10:5506567-5506589 TCTGGTTGCATCCACTGTACAGG No data
1063368516_1063368523 18 Left 1063368516 10:5506526-5506548 CCAGGGAGAGCTGGAGACAAGAA No data
Right 1063368523 10:5506567-5506589 TCTGGTTGCATCCACTGTACAGG No data
1063368513_1063368523 24 Left 1063368513 10:5506520-5506542 CCCATCCCAGGGAGAGCTGGAGA No data
Right 1063368523 10:5506567-5506589 TCTGGTTGCATCCACTGTACAGG No data
1063368521_1063368523 -7 Left 1063368521 10:5506551-5506573 CCCTCGGCTTAGGAGCTCTGGTT No data
Right 1063368523 10:5506567-5506589 TCTGGTTGCATCCACTGTACAGG No data
1063368514_1063368523 23 Left 1063368514 10:5506521-5506543 CCATCCCAGGGAGAGCTGGAGAC No data
Right 1063368523 10:5506567-5506589 TCTGGTTGCATCCACTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063368523 Original CRISPR TCTGGTTGCATCCACTGTAC AGG Intergenic