ID: 1063368828

View in Genome Browser
Species Human (GRCh38)
Location 10:5507845-5507867
Sequence TGGACTTCAGCCCAGCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063368828_1063368838 22 Left 1063368828 10:5507845-5507867 CCTACCTGCTGGGCTGAAGTCCA No data
Right 1063368838 10:5507890-5507912 CCTGCCACCCTTGAATTGGTCGG No data
1063368828_1063368830 -10 Left 1063368828 10:5507845-5507867 CCTACCTGCTGGGCTGAAGTCCA No data
Right 1063368830 10:5507858-5507880 CTGAAGTCCAGCCGCAATGCAGG No data
1063368828_1063368831 -9 Left 1063368828 10:5507845-5507867 CCTACCTGCTGGGCTGAAGTCCA No data
Right 1063368831 10:5507859-5507881 TGAAGTCCAGCCGCAATGCAGGG No data
1063368828_1063368840 24 Left 1063368828 10:5507845-5507867 CCTACCTGCTGGGCTGAAGTCCA No data
Right 1063368840 10:5507892-5507914 TGCCACCCTTGAATTGGTCGGGG No data
1063368828_1063368842 28 Left 1063368828 10:5507845-5507867 CCTACCTGCTGGGCTGAAGTCCA No data
Right 1063368842 10:5507896-5507918 ACCCTTGAATTGGTCGGGGCTGG No data
1063368828_1063368839 23 Left 1063368828 10:5507845-5507867 CCTACCTGCTGGGCTGAAGTCCA No data
Right 1063368839 10:5507891-5507913 CTGCCACCCTTGAATTGGTCGGG No data
1063368828_1063368832 -8 Left 1063368828 10:5507845-5507867 CCTACCTGCTGGGCTGAAGTCCA No data
Right 1063368832 10:5507860-5507882 GAAGTCCAGCCGCAATGCAGGGG No data
1063368828_1063368835 18 Left 1063368828 10:5507845-5507867 CCTACCTGCTGGGCTGAAGTCCA No data
Right 1063368835 10:5507886-5507908 TCTCCCTGCCACCCTTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063368828 Original CRISPR TGGACTTCAGCCCAGCAGGT AGG (reversed) Intergenic
No off target data available for this crispr