ID: 1063369633

View in Genome Browser
Species Human (GRCh38)
Location 10:5512638-5512660
Sequence ACCTCATCTCCAAAGGCGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1063369633_1063369637 19 Left 1063369633 10:5512638-5512660 CCGTGCGCCTTTGGAGATGAGGT No data
Right 1063369637 10:5512680-5512702 TCATTTTACACATGCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1063369633 Original CRISPR ACCTCATCTCCAAAGGCGCA CGG (reversed) Intergenic
No off target data available for this crispr